Preparation method and application of CpG motif-containing nucleotide sequence

A nucleic acid sequence and sequence technology, which is applied to medical preparations containing active ingredients, DNA preparation, pharmaceutical formulations, etc., can solve the problems of unacceptable production, high blindness, and high sequence costs, and achieves low cost and low cost. , the effect of stable performance

Active Publication Date: 2011-12-28
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the problem is that artificially synthesized CpG oligonucleotides are easily degraded, and thio-modified sequences are expensive and cannot be accepted for production; while the genomic DNA of lower organisms contains unmethylated CpG motifs, However, it is possible to introduce harmful genes or substances into the body, and the blindness is greater

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of CpG motif-containing nucleotide sequence
  • Preparation method and application of CpG motif-containing nucleotide sequence
  • Preparation method and application of CpG motif-containing nucleotide sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Preparation of Nucleic Acid Sequence Containing CpG Motif

[0038] 1. Design and synthesis of B sequence

[0039] According to the species specificity of the CpG sequence, the B sequence with immunostimulatory activity on chicken, pig and mouse was designed: 5'-GTTCCTGACGTTGGTGCATCGATGCAGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGCTAGACGTTAGCGT-3', synthesized by Dalian Biotechnology Co., Ltd.

[0040] 2. Preparation of nucleic acid sequences containing CpG motifs Artificially synthesized six primers with restriction sites and protective bases at both ends, the sequences are as follows:

[0041]

[0042] (1) Construction of recombinant plasmid pMD18-T-B1

[0043] The B sequence was cloned into the pMD18-T vector to construct the recombinant plasmid pMD18-T-B1. The specific operation method is carried out according to the instruction manual of pMD18-T vector.

[0044] (2) The construction of recombinant ...

Embodiment 2

[0175] Example 2 Application of Nucleic Acid Sequence Containing CpG Motif in Inactivated Bird Influenza Vaccine

[0176] Thirty female mice aged 3-4 weeks were randomly divided into 3 groups, 10 in each group. The nucleic acid sequence containing the CpG motif prepared in Example 1 was used as an adjuvant for the avian influenza H9N2 inactivated antigen (Nanjing Tianbang Biotechnology Co., Ltd.) to prepare an inactivated vaccine to immunize mice, and the mice were first immunized at the age of 28 days. Immunization was boosted 2 weeks later. See Table 1 for animal grouping details.

[0177] Table 1 Summary table of group description of immunized mice

[0178]

[0179] Blood was collected from the mice before immunization, once a week after immunization, serum was separated, and the titer of hemagglutination inhibitory (HI) antibody was determined (refer to the "Regulations of the People's Republic of China for Veterinary Biological Products" erythrocyte agglutination inh...

Embodiment 3

[0184] Example 3 Application of Nucleic Acid Sequence Containing CpG Motif in Newcastle Disease Inactivated Vaccine

[0185] Dilute Newcastle disease virus (NDV, Nanjing Tianbang Biotechnology Co., Ltd.) to a virus content of 1.0*10 8.5 EID 50 / 0.1mL, 0.3*10 8.5 EID 50 / 0.1mL and 0.1*10 8.5 EID 50 / 0.1mL 3 concentrations (standard poison, 3.3-fold dilution, 10-fold dilution). The nucleic acid sequence containing the CpG motif was mixed at 30 μg / 0.1 mL antigen, and the oil emulsion vaccine was prepared by conventional methods (oil phase:water phase=3:1). 105 healthy chicks were randomly divided into 7 groups, 15 in each group. Groups A to F were immunized by intramuscular injection of corresponding vaccines, each with 0.2 mL. Group G was the healthy control group, and each mouse was injected with 0.2 mL of white oil intramuscularly. See Table 3 for details.

[0186] Table 3 Summary table of grouping instructions for chicks immunized with Newcastle disease inactivated a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method and application of a CpG motif-containing nucleotide sequence and relates to the fields of molecular biology and animal immunology. The method for preparing the nucleotide sequence comprises the following steps of: constructing a recombinant plasmid pMD18-T-B1, a recombinant plasmid pMD18-T-B12, a recombinant plasmid pMD18-T-B1, a recombinant plasmid pMD18-T-B123, a recombinant plasmid pMD18-T-3B, a recombinant plasmid pMD18-T-6B and a recombinant plasmid pSP-6B; and preparing the CpG motif-containing nucleotide sequence by taking the recombinant plasmid pSP-6B as a template and a 3'-end sulfo-modified random sequence 5'-NpNpNpNpsNpsN-3' as a primer through a rolling circle amplification method. The CpG motif-containing nucleotide sequence serving as an adjuvant has higher immunological enhancement, and the preparation method is suitable for producing the sequence in large scale and has low cost.

Description

technical field [0001] The invention relates to a preparation method and application of a nucleic acid sequence containing a CpG motif, and relates to the fields of molecular biology and animal immunology. Background technique [0002] New immune adjuvants are one of the research hotspots in modern immunology. In recent years, a large number of studies have shown that the unmethylated CpG dinucleotide sequence (ie, CpG motif) with the structural characteristics of 5'purine-purine-CpG-pyrimidine-pyrimidine 3' in bacterial DNA can activate a variety of animal The poultry immune system activates B lymphocytes, macrophages (MΦ), dendritic cells (DC), natural killer cells (NK) and other immune cells, induces natural immune responses, and secretes IL-1β, IL-12, TNF -α, IFN-α, IFN-γ and other Th1-based cytokines are considered to be one of the most potential new immune adjuvants. In vitro and in vivo tests have shown that artificially synthesized deoxyoligonucleotides containing ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/10C12N15/66A61K39/39
Inventor张金秋卢宇邓碧华徐海吕芳侯继波
OwnerJIANGSU ACAD OF AGRI SCI