Methylated DNA detection method based on melting curve

A detection method and melting curve technology, applied in biochemical equipment and methods, microorganism determination/inspection, etc., can solve the problems of complex method, low detection sensitivity, easy to be interfered, etc. Not easily disturbed

Active Publication Date: 2012-04-04
江苏元丞生物科技有限公司
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method can effectively eliminate the influence of unmethylated DNA, enrich the methylated DNA in the sample, and solve the shortcomings of the existing technology, such as low detection sensitivity, complicated methods, and easy interference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methylated DNA detection method based on melting curve
  • Methylated DNA detection method based on melting curve

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach ( 1

[0034] Step 1: Treat the test DNA and known standard unmethylated DNA and methylated DNA with sulfite.

[0035] Step 1: Treat and purify known standard unmethylated DNA and methylated DNA with sulfite, make gradient dilution of the treated methylated DNA, and mix with a certain amount of unmethylated DNA as DNA sample to be tested;

[0036] Wherein, the standard methylated DNA and the standard unmethylated DNA are known methylated DNA and unmethylated DNA; the sulfite is specifically sodium sulfite; the sulfite treatment step of the DNA to be tested To denature the DNA to be tested with 0.3M NaOH, add a mixture of 5M sodium sulfite and 0.5mM hydroquinone with a pH value of 5.0, and incubate at 60°C in the dark for 4 hours; desulfurize and purify the DNA.

[0037] The unmethylated cytosine (C) in the DNA to be tested is converted into uracil (U) through the above treatment process, and the methylated cytosine (C) remains unchanged.

[0038] Step 2: Determine the detection reg...

Embodiment approach ( 2

[0056] On the basis of embodiment (1), DNA extracted from actual clinical samples was used as the sample to be tested, and the practicability of the present invention was tested under the same conditions as the above embodiment (1).

[0057] Among them, the same conditions as in the above-mentioned embodiment (1) mean that all operations are the same as the above-mentioned embodiment (1) except that the DNA extracted from the actual clinical sample is used as the sample to be tested.

[0058] The clinically extracted DNA samples to be tested are human normal and cancer cell DNA, tumor tissue genomic DNA, blood cell DNA, serum DNA, various body fluid DNA or various excrement DNA samples.

[0059] The cancer cells can be lung cancer cells, gastric cancer cells, colon cancer cells, rectal cancer cells, liver cancer cells, breast cancer cells, lymphoma cells, bladder cancer cells, ovarian cancer cells, kidney cancer cells or pancreatic cancer cells; The tissue can be lung cancer t...

Embodiment approach ( 3

[0061] On the basis of the implementation methods (1) and (2), taking the sequence of the transcription promoter region of the P16 gene as an example, the specific PCR primers are designed as follows:

[0062] Methylation of the transcription promoter region of P16 gene is a characteristic of many cancer cells such as lung cancer. The sequence of the transcription promoter region of the P16 gene is as follows, and the underlined part is the selected region to be detected.

[0063] Homo sapiens p16 protein (CDKN2A) gene, CpG island and partial cds, DQ325544.1

[0064] CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGCGCTGCCCAACGCACCGAATAGGATTACGCCG

[0065] Methylated DNA sequence, the underlined part is the region to be detected;

[0066] CGGATCGCGTGCGTTCGGCG GTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGGCGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a methylated DNA detection method comprising steps that: step1, a DNA sample is treated by using sulfite; step 2, PCR primers are designed and synthesized; step 3, PCR amplifications are respectively carried out with a standard unmethylated DNA and a standard methylated DNA as templates, and melting temperatures are measured; step 4, the DNA sample requiring detection is subject to PCR amplification; step5, a PCR amplification product is heated to a temperature between the PCR product melting temperature corresponding to the standard unmethylated DNA and the PCR product melting temperature corresponding to the standard methylated DNA; step 6, digestion is carried out; step 7, a secondary PCR amplification is carried out, a melting curve is measured, and the existence of a methylated DNA is detected. The method has important significances in respects of tumor early-stage detection, customized treatment, pathogenetic condition determination and reoccurrence monitoring.

Description

technical field [0001] The invention relates to a method for detecting methylated DNA, in particular to a method for detecting methylated DNA that is not susceptible to interference. Background technique [0002] DNA methylation refers to 5 of the cytosine (C) residues at CpG sites on the DNA strand ’ A methyl group is modified on the carbon. DNA methylation is one of the first DNA modifications discovered and is an important part of epigenetics. DNA methylation characteristically occurs on cytosine (C) residues of CpG dinucleotides on the DNA strand, which is commonly found in gene 5 ’ expression control sequences. DNA methylation plays an important role in the regulation of gene expression, and is involved in animal embryonic development, gene imprinting, and X chromosome inactivation. Studies have shown that changes in DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability and protein interaction, thereby controlling gene expression....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor王建
Owner江苏元丞生物科技有限公司