Novel purpose of microRNA-30 family
A family and role technology, applied in the new application field of the microRNA-30 family, which can solve the problem of unclear proteinuria and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Application of microRNA30 family as podocyte injury markers in patients with focal segmental glomerulosclerosis (FSGS)
[0032] The microRNA-30 family is one of the important components of microRNAs. The human and mouse microRNA-30 families include five members: microRNA-30a, microRNA-30b, microRNA-30c, microRNA-30d, and microRNA-30e. The five members of the microRNA-30 family are all expressed in podocytes (human, rat, mouse) and are abundant. In the application of the microRNA30 family as a marker of podocyte injury in patients with focal segmental glomerulosclerosis (FSGS), the specific detection methods are:
[0033] (1) In situ hybridization
[0034] Kidney tissue paraffin specimens were freshly prepared for xylene dewaxing, dehydrated with graded alcohol, and freshly prepared with 0.5% H 2 o 2 Treat at room temperature for 30 minutes to inactivate endogenous peroxidase; freshly prepare protease (0.01g / L) with 3% citric acid, and treat at 37°C for 10 m...
Embodiment 2
[0038] Example 2 The new application of the microRNA-30 family in the preparation of podocyte therapeutic drugs
[0039] (1) Plasmid transfection method
[0040] 1) MicroRNA-30a plasmid construction: ① Gene sequence synthesis: use pSilencer2.0U6 plasmid as a carrier, synthesize microRNA-30a sequence by PCR method, and add BamHI restriction site (GATCC) at the 5' end, and add HindⅢ ( A) Restriction site, and add 5 Ts as the terminator of RNA polymerase III, the final synthesized sequence is
[0041] gatccgcgactgtaaacatcctcgactggaagctgtgaagccacagatgggctttcagtcggatgtttgcagctgcttttta and simultaneously synthesized microRNA30a reverse complementary pairing sequence gtaaaaagcagctgcaaacatccgactgaaagcccatctgtggcttcacagcttccagtcgaggatgtttacagtcgcggatcttcga. ②Use a PCR instrument to anneal and ligate the above-mentioned single-stranded oligonucleotide fragments; ③The vector pSilencer2.0U6 plasmid is linearized and recovered: add the vector pSilencer2.0U6 plasmid (10 μl), BamHI enzyme (...
Embodiment 3
[0049] Embodiment three plasmid animal experiments
[0050] Injection method of microRNA-30a plasmid in rat tail vein:
[0051] (1) MicroRNA-30a plasmid preparation (the method is the same as the plasmid transfection method in Example 2).
[0052] (2) Tail vein injection of microRNA-30a plasmid: the specific operation is as follows. Wistar rats were anesthetized without anesthesia or 10% chloral hydrate (dose 3ml / Kg), and injected 80ml / kg into the tail vein with a 24G intravenous trocar Ringer's solution (containing 100 μg plasmid encoding microRNA-30a gene), the injection was completed within 10 seconds.
[0053] The result is as Figure 4 As shown, the microRNA-30a plasmid treatment can significantly reduce the 24-hour proteinuria of PAN rats, and the proteinuria of the rats was significantly increased by 117±53mg on the 5th day, 7th day, and 9th day after PAN (5mg / 100g) injection / 24h, 182±75, 235±60, after microRNA-30a plasmid tail vein injection on the 5th day, 7th day...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com