Promoter OsP002, preparation method and applications thereof
A promoter and plant technology, applied in the field of plant genetic engineering, can solve problems such as limited regulatory effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1: PCR amplification of P002 promoter fragment and construction of pMD18-T+P002 recombinant vector.
[0066] 1. PCR amplification of the P002 promoter fragment:
[0067] Using the Plant Genomic DNA Extraction Kit (TIANGEN New Plant Genomic DNA Extraction Kit, catalog number: DP320-02) to extract rice Nipponbare (the application number is
[0068]200910238992.0, the invention title is "A kind of promoter BgIosP587, its preparation method and application" is preserved in the invention application, and published on September 22, 2010, the preservation number is CCTCC NO: P200910) Genomic DNA, according to the promoter In the sequence in rice Nipponbare gDNA, design a pair of PCR specific amplification primers at the beginning and end respectively (upstream primer F1, plus restriction enzyme cutting site EcoR I and protection base, downstream primer R1, plus restriction enzyme cutting site SbfI and protected bases). Using the gDNA of rice Nipponbare extracted abov...
Embodiment 2
[0079] Example 2: Construction of vector-p8+P002 recombinant vector.
[0080] 1. Construction of p8 plasmid:
[0081] The p8 plasmid used in the present invention is provided by pCAMBIA-1301 plasmid (Dong Yang, Kunming Institute of Zoology, Chinese Academy of Sciences; or can be purchased from, for example, Shanghai Guorui Gene Technology Co., Ltd., the original source of the company's pCAMBIA-1301 plasmid is The CAMBIA Bios (biological open source) Licensee, Australia) was modified and constructed in the following way, and the specific instructions are as follows:
[0082] use as figure 1 The indicated Kpn I / Nco I (NEB) double enzyme digested plasmid pCAMBIA-1301, and recovered large fragments. Synthesize the following sequence according to the restriction endonuclease sites employed:
[0083] GGTACCAAGCTTACTAGTCCTGCAGGTCTAGAGGATCCGTCGACCATGG (SEQ ID NO: 6) (restriction site included is Kpn I / HindIII / Spe I / Sbf I / Pst I / Xba I / BamH I / SalI / Nco I), with Kpn I / Nco I double enzym...
Embodiment 3
[0101] Example 3: Preparation of recombinant Agrobacterium tumefaciens EHA105-P002 cells.
[0102] The p8+P002 recombinant vector constructed as described in Example 2 and the p8 plasmid as a control were respectively transformed into root cancer prepared by the calcium chloride method described in the "Molecular Cloning Experiment Guide" (third edition, Science Press). Agrobacterium EHA105 (has been preserved in the invention application with the application number 200910238992.0 and the invention name "A promoter BgIosP587, its preparation method and use", and was published on September 22, 2010, and the preservation number is CCTCC NO: M209315 ) competent cells, the specific method is as follows: take out the competent cells of Agrobacterium tumefaciens EHA105 from the ultra-low temperature refrigerator, and thaw on ice. After thawing, add 5 μl of p8+P002 recombinant vector and p8 plasmid and p8 empty vector as a control, mix gently, ice bath for 10 minutes, freeze in liqui...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
