Supercharge Your Innovation With Domain-Expert AI Agents!

Primer composition for detecting harmful gene of cattle blood coagulation factor XI deficiency, kit with primer composition and application of kit

A technology of primer composition and blood coagulation factor, applied in biochemical equipment and methods, recombinant DNA technology, measurement/testing of microorganisms, etc., can solve the problem of unreliable methods for screening bovine blood coagulation factor XI deficiency harmful gene carriers, blood coagulation Reduced factor XI activity, affecting prothrombinase synthesis, etc., to achieve excellent amplification specificity, avoid false negatives, and avoid low product concentrations

Active Publication Date: 2014-03-12
SOUTH CHINA AGRI UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inserted nucleotide sequence is mainly composed of adenine, so the position of the coding region forms a strong terminator, which hinders gene expression, so that it cannot synthesize a protein with a complete sequence, affects the synthesis of prothrombinase, and causes coagulation factor XI decreased activity of (Grzybowski et al, 1998)
However, there is still no report on a reliable method for screening harmful gene carriers of bovine coagulation factor XI deficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition for detecting harmful gene of cattle blood coagulation factor XI deficiency, kit with primer composition and application of kit
  • Primer composition for detecting harmful gene of cattle blood coagulation factor XI deficiency, kit with primer composition and application of kit
  • Primer composition for detecting harmful gene of cattle blood coagulation factor XI deficiency, kit with primer composition and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 preparation screening bovine coagulation factor XI Deletion Nested PCR Reaction Kit

[0033] 1. Primer design

[0034] According to the FXI gene sequence (Genebank: AH013749.2) on the NCBI website combined with the overall idea of ​​the present invention, the design of the primers was continuously analyzed, summarized and adjusted, and finally a 76bp sequence that occurred on exon 12 of the bovine chromosome 27 gene was inserted into this One mutation, a nested PCR method for detecting harmful genes of bovine coagulation factor XI deficiency was designed, and primer 1, primer 2, primer 3 and primer 4 were obtained. The sequence is shown as SEQ ID NO.1-4:

[0035] Primer 1: SEQ ID NO.1: GTGTTGAAGGGTGGAAAAAGTATTCATTG;

[0036] Primer: 2: SEQ ID NO.2: CTTTGCAGCCCTTCTCCCTTTTTAATG;

[0037] Primer 3: SEQ ID NO.3: GTCGAGTCACCTAATGTGTTG;

[0038] Primer 4: SEQ ID NO. 4: CCGTACCTGTGTAATTCATTGTC.

[0039] Among them, primer 1 and primer 2 are primer set A (...

Embodiment 2

[0051] Example 2 Using the nested PCR reaction kit prepared in Example 1 to detect cow coagulation factors XI Deletion disorder

[0052] 1. Extraction of whole DNA from bovine blood

[0053] The jugular vein blood sampling method randomly collected blood samples of 243 Holstein cows in an isolation farm in Jiangsu, 5mL / head, and placed them in vacuum heparin sodium anticoagulant tubes, shaken well, then divided them into 2mL tubes with centrifuge tubes, and stored them frozen at -20°C for later use .

[0054] Promega Maxwell 16 Automatic Nucleic Acid Extractor was used to extract blood genomic DNA, and a matching kit (AS1010 from Promega Company) was used. Promega's AS1010 kit contains Maxwell 16 Blood DNA Cartridges, Purification Plungers, Elution Tubes, and Elution buffer. The operation was carried out according to the instructions of the kit, and the DNA extraction of 16 samples could be completed approximately every 28 minutes after the instrument was started. After...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer composition for detecting a harmful gene of cattle blood coagulation factor XI deficiency, a kit with the primer composition and an application of the kit. The primer composition disclosed by the invention is composed of a primer group A and a primer group B, wherein the primer group A is composed of a primer 1 and a primer 2, the primer group B is composed of a primer 3 and a primer 4, and the nucleotide sequences of the primer 1, the primer 2, the primer 3 and the primer 4 are respectively shown as SEQIDNO. 1-4. The invention also provides the kit with the primer composition. The method for applying the kit disclosed by the invention to the detection of the harmful gene of the cattle blood coagulation factor XI deficiency comprises the steps of extracting the complete set of DNA (Deoxyribonucleic acid) in cattle blood as a template to carry out nested PCR (Polymerase Chain Reaction) amplification to obtain a PCR product, and carrying out gel electrophoresis on the obtained PCR product so as to directly know about the basic group change on a mutation site according to an electrophoresis result and sequence the PCR product, thereby ensuring the accuracy of the result and meeting the requirements of a detecting technology for characteristics such as high speed, precision, high throughput and the like.

Description

technical field [0001] The present invention relates to the field of biotechnology. More specifically, it relates to a primer composition for detecting harmful genes of bovine blood coagulation factor XI deficiency, a kit and application thereof. Background technique [0002] With the popularization and application of artificial insemination and embryo transfer technology, the wide application of dairy cow germplasm (embryo, semen, and bulls) around the world has significantly improved the genetic performance and accelerated the impact of recessive genetic diseases on cattle. group hazards. In particular, an excellent breeding bull can produce hundreds of thousands of doses or even millions of doses of frozen semen in its lifetime. If it carries a recessive genetic defect gene, it may spread rapidly all over the world and bring huge economic benefits to the production of animal husbandry. loss. my country mainly imports a large number of excellent germplasm of dairy cows ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6848C12Q1/686C12Q2549/119C12Q2531/113
Inventor 郭霄峰代元元吴晓薇
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More