Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof

A molecular marker and rice flag leaf technology, applied in the field of agricultural biotechnology engineering, can solve problems such as inability to establish, slow progress in functional research, and difficulty in revealing the molecular mechanism of leaves, so as to achieve the effect of improving efficiency and increasing the width of flag leaves

Active Publication Date: 2014-06-18
CHINA NAT RICE RES INST
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in general, the number of genes related to leaf shape development isolated from rice is still relatively small, coupled with the slow progress in functional research, it is not yet possible to establish an effective gene regulatory network system, and it is difficult to better understand from the molecular level. Unraveling the molecular mechanism of leaf development
At present, the research on the mechanism of leaf morphogenesis of monocot model crops and major food crops rice from the molecular level is still in its infancy, and the research on the regulation mechanism of leaf shape development is still insufficient, which hinders the molecular regulation to a certain extent. The implementation of establishing ideal plant type, the exploration and application of the mechanism of high-yield breeding of super rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof
  • Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof
  • Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1. Identification of polymorphisms in japonica Nipponbare and indica 93-11 using CAPS marker NAL1-Nar I

[0077] The specific method is: select the rice material Nipponbare and 93-11 from the germplasm resource bank of the China Rice Research Institute, hybridize with Nipponbare and 93-11 to obtain its F1, use the primer CAPS to mark NAL1-Nar I to amplify and use Nar I to identify its polymorphism ( figure 1 ).

[0078] 1. DNA extraction

[0079] 1) Prepare DNA extraction buffer:

[0080] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005M EDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA ; 2M NaCl; 0.055M CTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (that is, the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to prepare DNA Extraction buffer; final concentration of sodium bisulfite in DNA extraction buffer is 0.0...

Embodiment 2

[0108] Example 2. Using the CAPS molecular marker NAL1-Nar I to identify the sequence difference between the japonica rice Nipponbare containing the broad-leaf gene and the narrow-leaf gene 93-11

[0109] The specific method is: use the CAPS molecular marker NAL1-Nar I to perform PCR amplification on the genomic DNA of Nipponbare and 93-11, and entrust Shanghai Yingjun Biotechnology Co., Ltd. Sequencing, comparing the differences in their sequences ( figure 2 ).

[0110] 1. DNA extraction

[0111] With embodiment 1.

[0112] 2. PCR amplification

[0113] With embodiment 1.

[0114] 3. Electrophoresis detection, recovery and sequencing

[0115] The electrophoresis detection and recovery are the same as in Example 1; the recovered PCR products are entrusted to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing, and the sequencing results are shown in diagram 2-1 and 2-2.

[0116] 4. Nar I digestion reaction and electrophoresis detection of digestion products

[01...

Embodiment 3

[0121] Example 3, Utilizing CAPS molecular marker NAL1-Nar I to carry out assisted selection breeding of broad-leaved rice

[0122] The specific method is: the donor parent Nipponbare containing the broad-leaf gene is sequentially crossed, backcrossed and selfed with the indica rice variety 93-11, and the obtained offspring are combined with the assisted selection of the CAPS molecular marker NAL1-Nar I to select the segregation population with A single plant with the same type as the Japan Sunny Zone was used for breeding improvement of flag leaf width.

[0123] 1. DNA extraction

[0124] With embodiment 1.

[0125] 2. PCR amplification

[0126] With embodiment 1.

[0127] 3. Electrophoresis detection and recovery

[0128] With embodiment 1.

[0129] 4. Nar I digestion reaction and electrophoresis detection of digestion products

[0130] With embodiment 1.

[0131] 5. CAPS molecular marker NAL1-Nar I for assisted selection breeding of broad leaves

[0132] The japonic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CAPS (Cleaved Amplified Polymorphic Sequence) molecular marker NAL1-Nar I of a paddy rice flag leaf width controlling gene NAL1. A molecular marker primer is selected from the following primer pair by taking paddy rice as a species, wherein nucleotide sequences are 5'-3', NAL1-Nar I: a forward direction (F): CCCTCTATTCATTTGCATTCATC, and a reverse direction (R): GGCTGTCCACAATGACAATAAA. The invention also discloses application of the molecular marker NAL1-Nar I in the auxiliary selective breeding of a paddy rice wide flag leaf strain / or an offspring thereof. The application is particularly as follows: when the offspring of nipponbare and indica type rice 93-11 is screened, an individual plant with a banding pattern the same as the banding pattern of the nipponbare is selected from the offspring for breeding.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker related to rice flag leaf shape regulation gene NAL1 and an obtaining method thereof. Background technique [0002] Rice leaf morphology has always been concerned by breeders and plays an important role in rice plant type breeding. Improving the leaf shape of rice can increase the leaf area index and enhance the photosynthetic efficiency of the leaves, providing a reliable guarantee for stable and high yields. Leaf is an important part of rice plant, and it is the main place for photosynthesis; the slightly rolled upright leaf shape is one of the important morphological characteristics of an ideal plant, which has been directly or indirectly used in the ideal plant type breeding of rice. The moderate inward turning of the leaves can make the leaves straight to reduce the occurrence of drooping, and the effect is obvious at the later stage of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68A01H5/00
Inventor张光恒钱前王莉曾大力饶玉春胡江朱丽徐杰郭龙彪高振宇董国军任德勇颜美仙胡兴明
OwnerCHINA NAT RICE RES INST