82 results about "Leaf width" patented technology

A radiation therapy apparatus has a multi-leaf collimator device having a pair of collimator components which respectively comprise a plurality of leaves arranged close to one another such that the leaves face one another across an irradiation axis, and configured to set a desired irradiation field by individually moving the leaves. One of the collimator components is arranged with an offset with respect to the other collimator component, within a range of a leaf-width.

A forward cross-flow propeller technology for submarine ships, especially the installation of a cross-flow drill propeller at the front of the submarine (ship), the three-dimensional super-side arc of the rotor blade is 30°-720° and the blade height and blade width , blade pitch gradual change through the paddle wheel mother shell and the rotor wheel body as a whole, the "ellipsoidal crown body" with super strong stress and rigid body, the rotor structure of the dynamic balance rotating outer profile, the cavitation disk arm of the stator through-flow tube is formed by umbrella-shaped injection The ultra-low (negative) pressure semi-ellipsoid super-supercavitation area around the submarine ship may be filled with rubber carbon fiber airbags to eliminate most of the wave-making resistance of conventional ships and form submarine ships (especially submarines) to sail at super speed And the energy-saving and overspeeding propeller technology and "drill bit effect" working principle of the submarine ship of energy-saving most tractive power.

The invention relates to a method for producing fine denier terylene BCF filaments and a spinning plate. The method comprises the following steps of: (1) pre-crystallizing and drying terylene slices, and then melting and extruding the terylene slices through screws, wherein the terylene slices are PET and the viscosity is 0.64 to 1.0; (2) performing spinning through the spinning plate, wherein the hole number of the spinning plate is 330 to 380, the holes are circular holes or three-leaf holes, the aperture of the circular holes is 0.4 to 0.6 millimeters, the ratio of the length to the aperture is 1.5: 1 to 3: 1, the leaf width of the three-leaf holes is 0.1 to 0.1 millimeter, the leaf length is 0.5 to 0.8 millimeter, and the ratio of the length to the aperture is 2: 1 to 3: 1; (3) cooling, namely cooling with side air at the air speed of between 0.1 and 0.15 meter per second and at the temperature of between 18 and 25 DEG C; (4) oiling and drafting; (5) BCF bulking; and (6) cooling shaping, outputting, entanglement network and winding, wherein the fiber number of the fine denier terylene BCF filaments is 1,100 to 2,000 decitexes, and the fiber number of monofilaments is 3.06 to 5.56dpf.

A refrigeration cabinet, in particular a commercial refrigerator or freezer, is provided. The refrigeration cabinet has a housing, which has a front access opening, a door, which has at least one door leaf, for the access opening, and a guide. The door leaf has a height and a width and is mounted such that it can be rotated about a vertical rotation axis and can be displaced transverse to the rotation axis. The guide defines a movement of the door leaf between a closed position and an open position in such a way that the pivot region of the door leaf projects less than a full door-leaf width into the exterior in front of the access opening, and that the door leaf is mounted such that it can be rotated about a vertical axis and can be displaced transverse to the rotation axis.

The invention discloses a parameter template-based corn leaf virtual simulation modeling method. The method comprises the following steps: establishing a parameterized template library for corn leaves by scanning real corn leaves, wherein parameters comprise leaf lengths, leaf widths and leaf vein curves; searching a parameter template matching characteristic parameters from the template library according to the characteristic parameters of a target modeling corn leaf, wherein the characteristic parameters comprise a target leaf length, a target leaf width and a target leaf vein curve; and modeling the target modeling corn leaf according to the matched parameter template by taking the characteristic parameters as constrains. The method of the invention effectively solves the problem of structural modeling which is not easy to be expressed parametrically on the corn leaves; and the established model has strong sense of reality, which can meet the requirement on a digitized design of corn leaves.

The invention belongs to the field of molecular genetics, and particularly relates to a gene ZmNL4 for controlling corn leaf width and application of a related molecular marker to screening or improvement of a plant leaf width trait. The invention provides a sequence of the gene ZmNL4 for controlling the corn leaf width, and discloses an InDel locus significantly associated with the corn leaf width trait inside the ZDNL4 gene. The invention discloses a method for screening the corn leaf width trait by using the molecular marker developed on the basis of the InDel locus. Furthermore, the invention discloses a method for mutating ZmNL4 protein or identity protein thereof by genetic engineering means to reduce the plant leaf width.

The invention discloses a potted taxus chinensis dwarfing method. Dwarfing culture is realized by selecting a suitable seedling substrate, bending the top in the early growth period, reasonably controlling light intensity, temperature and water and fertilizer and effectively controlling growth. The dwarfed taxus chinensis is compact and non-dense and stretched and non-loose, and has multiple ornamental values of stem, branch, leaf and fruit ornamental due to red stems, red branches, green leaves and red beans; the dwarfed plant is robuster, leaf width is increased by 20-30%, the leaves are greener, and the ornamental value is higher.

The invention relates to a method for measuring the leaf area, the leaf perimeter, the leaf length and the leaf width. According to the method, firstly, an acquired leaf is scanned by a scanning module, and the scanned image of the leaf is saved in the picture format. Secondly, a model is constructed by the model builder of the ArcGIS software, and the constructed model is composed of an ISO clustering unsupervised classification module, a field operation module, and an input and output module. The ISO clustering unsupervised classification module, the field operation module and the input and output module form a friendly-interface tool. Thirdly, by means of the generated tool, a leaf image and an output path are inputted, and then the area, perimeter, length and width data of each leaf in a folder are generated. The method aims to provide a novel method for spatial analysis and graphics by means of the ArcGIS software. The tool is constructed by the model builder, and then accurate leaf parameters, including the leaf area, the leaf perimeter, the leaf length, the leaf width and the like, can be automatically acquired in batches.

The invention relates to a molecular marking method of a rice new gene source-sink 1 (SS1), and belongs to the fields of super-high-yield breeding of rice and molecular genetics. The essence of the invention is as follows: according to the interlocking separation law, an F2 secondary separation group constructed by autocopuation of a near-isogenic line carrying a SS1 heterozygous segment is takenas a test material for constructing a set of crossing and stacking system of a target segment, phenotype is further combined for performing high-precision interlocking analysis on a target gene, through two years of two-point repeated identification, the SS1 is finally precisely positioned in an interval of 55Kb on the fourth chromosome and a PCR (polymerase chain reaction)-based molecular mark FL41 which is closely interlocked with the SS1 is further obtained. Through the application of the molecular marking method in the super-high-yield breeding of rice, genotype individuals which can simultaneously affect the characters of a library (the number of grains per panicle) and a source (the flag leaf width and the leaf area) can be fast accurately identified, the early generation selection of breeding material can be performed further and the process of the super-high-yield molecular breeding of rice can be greatly accelerated.

The invention discloses a method for measuring stress-resistant capability of plants. Healthy seedlings relatively consistent in growth are cultured, plant seedlings which are used for inspection of the leaf growth condition are cultured by applying stress factors, the maximum leaf length and the maximum leaf width of the plants in different sizes are measured, and a leaf area model is established; just unfolded young leaves are selected to serve as target leaves, a change equation of the maximum leaf length, the maximum leaf width and the leaf areas of the target leaves with the culture time is established with a Logistic equation adopting four parameters, growth parameters of the leaf areas of the target leaves cultured under different stress conditions as well as the growth rate in half of the logarithmic phase and the lasting time of the logarithmic phase are obtained; the different-stress-resistant capability of the plants is judged according to the parameters. Through investigation of the maximum leaf length, the maximum leaf width and other easy-to-measure indexes of the plant leaves, dynamic changes of the maximum leaf length, the maximum leaf width, the leaf areas and other biomass parameters of the plant leaves can be rapidly acquired, the resistance capability of the plant to the outside stress can be timely fed back, the experiment is simple and convenient, and data are relatively reliable.

The invention discloses a CAPS (Cleaved Amplified Polymorphic Sequence) molecular marker NAL1-Nar I of a paddy rice flag leaf width controlling gene NAL1. A molecular marker primer is selected from the following primer pair by taking paddy rice as a species, wherein nucleotide sequences are 5'-3', NAL1-Nar I: a forward direction (F): CCCTCTATTCATTTGCATTCATC, and a reverse direction (R): GGCTGTCCACAATGACAATAAA. The invention also discloses application of the molecular marker NAL1-Nar I in the auxiliary selective breeding of a paddy rice wide flag leaf strain / or an offspring thereof. The application is particularly as follows: when the offspring of nipponbare and indica type rice 93-11 is screened, an individual plant with a banding pattern the same as the banding pattern of the nipponbare is selected from the offspring for breeding.

The invention relates to a detoxicating agent on tobacco deformity induced by quinclorac and an applying method thereof. The detoxicating agent is prepared from the following materials: 0.4%-0.6% of natural plant growth regulator, 3.6%-9.0% of plant microecology agent, 13.3%-31.6% of tobacco leaf nutrient and 61.3%-81.9% of efficiency enhancer. The applying method of the detoxicating agent comprises the following steps of: using 35-75 times of clean water to dilute 500g-900g of detoxicating agent for every 1000 tobacco plants, and uniformly spraying onto the tobacco plants and the positive and reverse surfaces of the tobacco leaves until the wet dew on the leaf surface has no water dripping in the early generation period of tobacco deformity induced by quinclorac. The invention obviously increases the leaf length of the tobacco leaf deformity induced by quinclorac, obviously increases the leaf width and total sugar, obviously decreases the nicotine, effectively removes the symptom of the tobacco leaf deformity induced by quinclorac, enables the tobaccom leaf to obviously recover the normal botany property and internal chemical quality, and has the advantages of strong compounding property of raw materials, simple preparation, high safety, strong point and high practical value in the tobacco leaf production.

The invention relates to a radiation breeding method for gardenia, and belongs to the technical field of plant breeding. The method comprises the following steps of: selecting an excellent gardenia tree, and cutting a branch as a radiation material; performing 60 Co-gamma ray radiation on the radiation material, wherein the radiation dosage is 20 to 25Gy; raising seedlings of the radiated branch by cutting, transplanting the seedlings after the seedlings raised by cutting survive, breeding the seedlings for three years, comparing the seedlings with a common seedling control group bred without radiation, screening the beneficial variable strains, and raising the seedlings by cuttage propagation to obtain optimized strains with stable trait inheritance. After the gardenia tree is grown up and enters a fruiting period, the flowering period and the fruit maturing period are shortened, the flowering time and the fruit maturing time are more centralized, the yield of fresh gardenia fruits is more than 750kg / mu, and the gardenoside content is over 5 percent; the pigment mass is more than 26.68 by using 1 centimeter of 1 percent 61 color scale E and 100 grams of raw medicament through detection; the plant height is 1.6 to 2.0 meters; the form is proper in branching, and the plant is green; the leaf length is 6 to 15 centimeters, the leaf width is 2.6 to 7 centimeters, the leaf edge is rolled inwards, and the leaves are thick and dark green; the full fruit length is 6 to 9 centimeters, the fruit length is 4.0 to 5.5 centimeters, the length of the fruit calyx is 2 to 3.5 centimeters, the fruit diameter is 2 to 2.5 centimeters, and the weight of the dried fruits is 7 kilograms; after maturing, the fruit is red; and the gardenia tree is a plant with strong cold resistance.

The invention discloses a prevention and control method for continuous cropping barriers of atractylodes macrocephala. The method comprises the steps of land selection, plowing, seed selection and seedling raising, field management, flower bud removing and harvesting, wherein a land with an appropriate slope after first-stubble atractylodes macrocephala is harvested and before the second-stubble atractylodes macrocephala is cultivated is selected for planting corn and soybeans; after preceding plants are harvested and turned over, sheep dung and cow dung are uniformly spread on the plants, then quick lime is spread, and full decomposing, ploughing and drying are carried out; a soil continuous cropping agent is added before transplanting, and ploughing is carried out again; then a broad-leaf high-pole atractylodes macrocephala strain is selected, from first frost to beginning of winter, the atractylodes macrocephala without diseases and insect pests and with plump bud heads at the top end and the weight of 9-12 grams is selected as seed atractylodes macrocephala, then 8000-15000 of basic seedlings are planted on ridges every mu and intercropped with corn; finally, field weed prevention and control, fertilization and field drainage and irrigation are carried out. By using the method, important traits such as plant height, crown breadth, stem diameter, leaf length, leaf width andbranching number are significantly improved, the occurrence of the soil borne root rot is reduced, and the content of atractylenolide is increased.

Effective utilization of vegetable called Ipomoea aquatica that although exhibiting high nutritional value and excellent antioxidant capability and ensuring huge supply capacity, is poor in distribution preservability and is notable in discoloration and quality degeneration attributed to processing, thereby disenabling merchandization of relevant processed food. There is provided a method of cultivating Ipomoea aquatica, characterized in that Ipomoea aquatica having been broadly classified as per flower color and leaf width is minutely classified as per whole leaf shape, leaf configuration appearing within a radius of equal to or less than 5.0 cm from leaf base and configurational difference among leaves from the same stem, and that an appropriate one is selected from among the resultant classes and cultivated. By virtue of this method, the distribution enduring period in fresh condition can be prolonged, and the discoloration by heating can be suppressed. Ipomoea aquatica can be resistant to discoloration by heating or freezing.

The invention discloses a mixed substrate for cultivation of Sedum lineare. The mixed substrate is prepared by mixing prefabricated decomposed compost and perlite, and the volume proportion of mixture of decomposed compost and perlite is 5:1. The pH value of the mixed substrate is 6.8, conductivity is 1.162.7uS / cm, unit weight is 0.6g / cm<3>, total porosity is 60.5%, ventilation gap is 28.4%, water-holding pore is 32.1%, organic matter is 53.4%, nitrogen is 2.5%, and phosphor is 0.7%. The invention also discloses a preparation method of the mixed substrate for cultivation of Sedum lineare. Urban garden greening waste and waste life sludge are mixed, decomposed compost and perlite are prepared for roof greening cultivation substrate, the substrate is suitable for roof growth of Sedum lineare with good cultivation effects; unit weight, porosity, contents of organic matters, nitrogen and phosphor and other characteristics satisfy requirements of roof greening cultivation medium, average branch length, leaf number, leaf width, leaf area and other growth vigor indices of cultivated Sedum lineare are obviously better than the indices of Sedum lineare cultivated by peat substrate and garden soil substrate, and the cultivation effects are good.

The invention discloses a Hippeastrum rutilum soilless potting medium. The Hippeastrum rutilum soilless potting medium comprises the following components: grass carbon, vermiculite, perlite and mushroom dregs, wherein the mass ratio of the grass carbon to the vermiculite to the perlite to the mushroom dregs is 0-4:0-2:0-3:0-3, the potting medium at least internally comprises two from the grass carbon, the vermiculite, the perlite and the mushroom dregs. According to the invention, after the medium is used, the leaf quantity, the leaf width and the plant height are increased, the diameter of a bulb is increased, plants grow tidily, roots are rich, and at the same time, the price of raw materials is low.

The invention discloses a protein PALS1 related to the plant height, the tiller number and the leaf shape of rice and an encoding gene and application of protein PALS1. The invention provides a protein which consists of amino acid sequences as shown in SEQIDNO:3, or a protein which consists of amino acid sequences which are substituted, deleted and / or inserted by one or more amino acid residues, as shown in SEQIDNO:3, and is related to the plant type and the leaf shape of rice and derived from SEQIDNO:3. The experiment shows that a PALS1 gene is separated and cloned from nipponbare, and the gene belongs to the CHR4 / MI-2-LIKE gene family. A transgenetic seedling obtained when rice is transformed by using an interference gene expressed carrier shows that the plant height, the tiller number, the leaf width and the leaf length of rice can be remarkably affected by the expression amount of PALS1, and the gene has certain application potential in plant type and leaf shape molecular breeding of rice.

The invention provides a dwarfing cultivation method of freesias and belongs to the technical field of agriculture. The method includes the steps of soaking bulbs in mepiquat chloride solution or ethephon solution, or spraying leafs. The mepiquat chloride solution or ethephon solution is used to treat bulbs of freesias so as to achieve dwarfing; after treatment is done using the method, nutritional growth of freesias can be significantly suppressed, plant height is decreased, the plants can be compact and dwarf and strong, and the plants blossom 5-7 days earlier; the treated plants are 1 / 2-1 / 4 as high as control plants and are generally 20-35cm in height; leaf width is increased by 20-40% and leaf color is deeper; flower ornamental characteristics such as color and pattern never change, and the method is very suitable for potting and water culture and has great application and economic value.

The invention discloses a method for transforming medicago sativa by the aid of galega orientalis gibberellin receptor genes GoGID. The method includes particular steps of inserting the genes GoGID into vector plasmid DNA (deoxyribonucleic acid); introducing vectors with the inserted genes GoGID into agrobacterium tumefaciens LBA4404; culturing the agrobacterium tumefaciens; preparing and transforming medicago sativa explants; verifying, propagating and evaluating medicago sativa transgenic plants. The method has the advantages that after the galega orientalis gibberellin receptor genes GoGID are overexpressed in the medicago sativa, the plant heights of transgenic medicago sativa can be increased by 0.2-0.35 time, biomass in the transgenic medicago sativa can be increased by 14.9-46.3%, and the leaf lengths and the leaf widths of the medicago sativa can be obviously larger than the leaf lengths and the leaf widths of wild type medicago sativa; in addition, the flowering time of the medicago sativa is delayed by a week as compared with the wild type medicago sativa, accordingly, theoretical basis can be provided for passing pasture gibberellin signal pathways, and possible candidate genes and theoretical foundations also can be provided for genetically improving yield traits of the medicago sativa.

The invention discloses an aquatic canna dwarfing method, and belongs to the technical field of agriculture. The method comprises the following steps: 1) selecting aquatic canna seeds for potting; 2)when the aquatic canna potted plants grow out of 4 and 5 buds of 2-3cm, and carrying out root leaching or spraying treatment by the paclobutrazol aqueous solution, the mepiquat chloride aqueous solution and the uniconazole aqueous solution in sequence, cultivating, and obtaining dwarfed aquatic canna. Through the successive treatment on the aquatic canna by the paclobutrazol aqueous solution, themepiquat chloride aqueous solution and the uniconazole aqueous solution, the dwarfing effect can be realized; by combining with a special nutrient solution, the height of the plants can be remarkablyreduced, the plants are compact and strong, and the height of the treated plants is 1 / 2-1 / 3 shorter than that of the compared plants, the leaf color is deepened, the leaf width is increased by 20-40%,and the thickness is increased by 10-20%.

The invention discloses an upland cotton transformation event ICR24001 and a specificity identification method thereof. A GhKCS2 gene is overexpressed in upland cotton CCRI24 to obtain transgenic cotton ICR24001, an exogenous DNA fragment of the transgenic cotton is inserted into the 68405357th-68405382th locus interval of a No. A11 chromosome of a target cotton genome to replace 24 bp base sequences in the 68405357th-68405382th locus interval of the No. A11 chromosome so as to obtain cotton. It is proved through tests that the transgenic cotton ICR24001 is not only higher than an acceptor material in fiber length, specific strength, uniformity and seed cotton yield and is also higher than the acceptor material in plant height, leaf length, leaf width, petiole length, petiole width, fruit branch number, boll forming number, single boll weight, ginning outturn and the like, and a foundation is laid for research of cultivation of the transgenic cotton having excellent fiber quality.

The invention provides a method for making crop irrigation strategies based on a leaf area increasing model and belongs to the application field of agricultural crop water-saving technology. The method employs a plant leaf area calculating equation to build a calculating model of leaf length, leaf width and leaf area, builds a relation model representing the change of leaf area along with time by using a four-parameter logistic equation, calculates relative time required for rise of leaf area increasing speed to the maximum under different water supply schemes according to the relation model representing the change of leaf area along with time, and makes a crop irrigation strategy according to the water supply scheme corresponding to the minimum value of the relative time required for rise of leaf area increasing speed to the maximum. The method has the advantages of simple steps, easy operation and nondestructive detection and can provide theoretical bases and data support for research on crop irrigation strategies.

The invention discloses a rice leaf width adjustment and control related microRNA (ribonucleic acid) as well as an encoding gene and application thereof. The RNA provided by the invention is one of 1)-4), namely 1) RNA consisting of a nucleotide sequence shown in the sequence 1 of a sequence table, 2) RNA consisting of a nucleotide sequence shown in the sequence 4 of the sequence table, 3) RNA consisting of a nucleotide sequence shown in the sequence 5 of the sequence table and 4) RNA which is substituted and / or lost and / or added from the RNA sequence shown in 1) or 2) or 3) through one or more basic groups, is related to plant leaf width, and is derived by 1) or 2) or 3). Experiments prove that Osa-miR319 and encoding gene thereof are discovered, the width of rice leaves can be effectively adjusted and controlled by utilizing the gene through a genetic engineering method, and the leaf shapes of rice can be changed.

The invention discloses Aspergillus niger SICU-33 capable of promoting plant growth and application thereof. The preservation number of the Aspergillus niger SICU-33 disclosed by the invention is CCTCC NO: M2019778, and the ITS sequence of the Aspergillus niger SICU-33 is SEQ NO.1. The strain not only can obviously inhibit the growth of plant pathogenic fungi, but also can promote the growth of plants, increases the leaf number, stem diameter, maximum leaf width, maximum leaf length, fresh leaf weight, fresh root weight, root length and leaf area of corn, and has a good application prospect.

The invention discloses a growth regulator specially used for leafy vegetables. The growth regulator is mainly prepared from following components, by weight, 5 parts of fulvic acid, 0.2-0.8 parts of gibberellin, 0.1-0.7 parts of ethephon, 0.1-0.5 parts of potassium sulfate, 0.2-0.6 parts of zinc sulfate, 10-20 parts of paeony and 15-25 parts of sophora flavescens. Compared with the prior art, the invention provides the growth regulator by which plant heights, leaf lengths, leaf widths, the content of chlorophyll and acre yield of the leafy vegetables can significantly improved. The growth regulator can significantly improve quality of the leafy vegetables and can reduce plant diseases and insect pests..

The invention discloses a plant leaf area measuring instrument. The plant leaf area measuring instrument comprises an image acquisition module, a data processing module, a data storage module and a display module, wherein the image acquisition module is connected with the data processing module and is used for measuring transverse leaf width, the data processing module is further connected with a FLASH memory and a liquid crystal display, the liquid crystal display is used for displaying the leaf information acquired by the image acquisition module in real time, and the FLASH memory is used for storing and saving the leaf information. The measuring instrument is advantaged in that offline operation can be realized, FPGA parallel processing capability is performed, high-speed image acquisition and processing can be realized through the image acquisition module and the data processing module, leaf area algorithm application programs are accomplished in a software mode, software and hardware cooperation design is realized, leaf area measurement on detached leaves is stable and reliable, other leaf parameters can be measured, and strong system flexibility is realized.

The invention provides a special sterilizing and strengthening agent for sugarcane tissue culture seedlings and a use method thereof. The agent comprises carbendazim, naphthylacetic acid and filling materials based on mass ratio of 1000:1. The use method comprises the following steps: weighing a reagent according to effective ingredient percentage to prepare into 0.3% of solution, soaking the sugarcane tissue culture seedlings for 3min, and then temporarily planting the seedlings in a seedling bed. The test result shows that for the temporarily planted sugarcane tissue culture seedlings treated by the formula, survival rate of grade 1 seedlings is 77.57%; compared with the seedlings through conventional treatment, survived plants have obviously improved quality with plant height increasedby 104.56%, leaf length increased by 89.37%, leaf width increased by 53.85%, root length increased by 105.52%, and obviously increased roots. The formula and the use method are applicable to popularization and application in sugarcane scientific research institutions and seedling production enterprises, and the formula can be also applicable to new product development for reagent manufacturers.

The invention discloses a dwarf culture method for gloxinias. The dwarf culture method includes culturing potted gloxinias in a greenhouse with the temperature of 25 DEG C plus or minus 3 DEG C; when the potted gloxinias start to differentiate to bud, evenly spraying a chlormequat chloride solution with the concentration of 400mg / L onto leaves and blossom bubs of the potted gloxinias once every five days by the leaf surface spraying method until the gloxinias are in full bloom. The potted gloxinias are sprayed with the solution for five to six times in total. According to the dwarf culture method, improvements are made on the basis of conventional potted-gloxinia greenhouse culture techniques, the gloxinias are sprayed with the chlormequat chloride solution with the specific concentration in a specific period, and plant heights, leaf lengths, leaf widths, pedicel growing trends of the gloxinias can be remarkably reduced, so that the ornamental value of the gloxinias is improved, and the problems that the petioles and rachises are broken as being overlength, the stems are easy to lodge due to slimness and fragility and the like are avoided.

The invention discloses a molecular marker FLW-7 of a nucleotide sequence of rice LOC_07g1200 of rice. With the rice as a species, a molecular marker primer is selected from primer pairs as shown in the specification, wherein the nucleotide sequence is 5'->3', FLW-7, forward: TGGGTGCTTCTTTTGTGGGA; reverse: TGCAGTTGTGAAGAAGTGGAGA. The invention also provides a method for developing the molecular marker FLW-7. The molecular marker FLW-7 disclosed by the invention is applied to identification of the width of the leaves of rice three-leaf stage and / or the assisted selection breeding of progeny broad-leaf plants. Specifically, when the progenies of Pei'ai 64S and Yangdao 6 are screened, an individual plant with the same banding pattern as the banding pattern of Yangdao 6 in progenies is selected for breeding a broad-leaf plant type.