Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

136 results about "Early generation" patented technology

Efficient management of cryptographic key generations

The invention generally relates to management of cryptographic key generations in an information environment comprising a key-producing side generating and distributing key information to a key-consuming side. A basic concept of the invention is to define, by means of a predetermined one-way key derivation function, a relationship between generations of keys such that earlier generations of keys efficiently may be derived from later ones but not the other way around. A basic idea according to the invention is therefore to replace, at key update, key information of an older key generation by the key information of the new key generation on the key-consuming side. Whenever necessary, the key-consuming side iteratively applies the predetermined one-way key derivation function to derive key information of at least one older key generation from the key information of the new key generation. In this way, storage requirements on the key-consuming side can be significantly reduced.
Owner:EMC CORP +1

Method for promoting human bone mesenchymal stem cell proliferation based on exosome

The invention relates to the field of biotechnology and mainly relates to a use of an early-generation human umbilical cord mesenchymal stem cell exosome in promotion of human bone mesenchymal stem cell growth. The use method is a method for promoting bone mesenchymal stem cell growth. The invention also relates to an extraction method of a human umbilical cord mesenchymal stem cell exosome. The early-generation human umbilical cord mesenchymal stem cell exosome and human bone mesenchymal stem cells are co-cultured so that human bone mesenchymal stem cell growth is obviously promoted, cell doubling time is shortened and a ratio of an S period in a cell period is increased.
Owner:SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY

Directed cultivation method for drought-resisting water-saving variety of winter wheat

The invention discloses a directed cultivation method for a drought-resisting water-saving variety of winter wheat. The directed cultivation method mainly comprises the following steps: A, selectively pairing and hybridizing excellent complementary parent materials; and B, carrying out directed cultivation to select a new strain with strong drought resistance and high yield, wherein the step B iscarried out according to the following operations: B-1, planting early-generation F1-4 materials under high water and fertilizer conditions, and selecting based on yielding ability; and B-2, taking higher-generation materials (above generation F5) in duplicate, respectively planting under high water and fertilizer conditions and drought stress conditions in an inter-generation water-drought alternation manner, and selecting the new strain with strong drought resistance and high yield. The selected new variety of winter wheat has outstanding drought resistance and water-saving property, and has the characteristics of high yielding potential and strong stress resistance.
Owner:DRY LAND FARMING INST OF HEBEI ACAD OF AGRI & FORESTRY SCI

Measurement method of absolute amylase content of rice

The invention relates to the technical field of food detection and particularly relates to a measurement method of absolute amylase content of rice. The method includes the steps of: by means of preparation and calibration of four standard samples in different content gradients, preparing a reagent for experiment; preparing and gelatinizing standard samples and to-be-test samples; performing iodine blue coloration and spectrophotometer colorimetric assay to the standard samples and to-be-test samples; and calculating the absolute amylase content of the to-be-test samples according to a linear equation according to the relationship of the light absorption value of the standard samples to the absolute amylase content. The method is simple, quick, accurate, low-cost and high-efficient, and has a great application prospect in rice quality measurement and rice breeding early generation screening.
Owner:CHINA NAT RICE RES INST

Evaluation of web pages

Determining a web page evaluation value includes obtaining a plurality of web pages with the same or approximately the same content; determining a plurality of generation times and a plurality of first evaluation values that correspond to respective ones of the plurality of web pages; identifying a web page among the plurality of web pages that has the earliest generation time; and determining a second evaluation value of the identified web page according to the plurality of first evaluation values.
Owner:ALIBABA GRP HLDG LTD

Molecular marker for assisted selection of green bean bruchid-resistant new gene Br3 and application of molecular marker

ActiveCN105368956AAccurate generation-by-generation trackingExemption from anti-bean elephant identification workMicrobiological testing/measurementDNA/RNA fragmentationEarly generationAgricultural science
The invention discloses a molecular marker for assisted selection of a green bean bruchid-resistant new gene Br3 and application of the molecular marker. The molecular marker is named as SYD404 and obtained by using genome DNA of a green bean variety V1128 as a template and adopting a pair of SSR primers for PCR (polymerase chain reaction) amplification, and a genetic distance between the molecular marker and the bruchid-resistant gene Br3 is 4.0cM. The molecular marker provides a good route for bruchid-resistant breeding of the green bean variety V1128, selection can be advanced to a green bean growth seedling stage, a lot of bruchid-resistant identification work which consumes time and labor can be avoided, early generation selection of breeding materials can be realized, and accurate successive generation tracking of target genes can be realized.
Owner:INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI

Cultivation method of maize inbred line

InactiveCN102334447AEasy to chooseImprove growth and development environmentPlant genotype modificationEarly generationPanicle
The invention discloses a cultivation method of a maize inbred line, comprising the following steps of: (1) selective breeding of an induced line ''Lanyu induced No.1'' with high induction frequency from inductive materials of different sources; (2) induction method: taking the inductive materials as female parent and the ''Lanyu induced No.1'' as male parent according to the breeding objective to perform a test-cross, firstly selecting a female parent plant with normal growth to remove tassel, holding up pistil before wiredrawing, pollinating female parent by using pollen of ''Lanyu induced No.1'' when wiredrawing of filament finishes, quickly carrying out pollination and simultaneously taking off paper bags, holding up the paper bags after pollination, hanging with tags and fixing, performing ten panicles for each test-cross combination, harvesting and drying by sun according to test-cross combination; (3) selecting of monoploid grain; (4) identifying and treating of monoploid seedling; (5) enhancing field fertilizer and water management as well as cultivating and weeding; (6) early generation test-cross: inducing the duplex second generation inbred line into normal growth and development, recovering to normal growth of plant morphological characteristics, screening the inbred line by early generation test-cross to obtain a qualified maize inbred line. The invention can be used to cultivate a rapid and stable maize inbred line.
Owner:沈天民

Preparation method of exosome and stem cell proliferation reagent containing exosome

The invention discloses a preparation method of exosome and a stem cell proliferation reagent containing the exosome. The preparation method of the exosome comprises the steps that 1, a culture mediumwithout exosome serum is added bone marrow mesenchymal stem cells to dilute the bone marrow mesenchymal stem cells into a cell suspension, the cell suspension is inoculated into a cell culture bottleto be cultured, supernate obtained after culture is collected, and the exosome is extracted; 2, cell fragments, dead cells and impurities in the supernate are removed; the supernate is removed, thena phosphate buffer salt solution (PBS) is added to dissolve and collect exosome precipitate, the exosome precipitate is filtered through a sterile filter membrane, and the obtained exosome precipitateis packaged in a sterile centrifugal tube and stored for later use. According to the method, in-vitro experiments prove that the proliferation activity and related functions of the mesenchymal stem cells can be remarkably promoted by co-culturing the exosome secreted by the early-generation bone marrow mesenchymal stem cells and human umbilical cord mesenchymal stem cells, and the method is an effective strategy for potentially improving the function of cells in a large-scale cell culture process.
Owner:广东芙金干细胞再生医学有限公司

Breeding method for once measuring quality of peanuts selected by multiple indexes

InactiveCN102177842AMake a measurementOptimizing Mutagenesis TechniquesSeed and root treatmentColor/spectral properties measurementsEarly generationHigh oleic acid
The invention relates to a crop quality analysis method, in particular to a rapid quantitative method applicable to breeding for quality of peanuts with multiple indexes. The breeding method for once measuring the quality of peanuts selected by multiple indexes is characterized by comprising the steps as follows: firstly, matching high-quality parent with hybridized combination and selecting true hybrid; or mutagenizing seeds; and secondly, carrying out quality selection on the seeds, wherein the selection of true hybrid is based on sequencing or utilizes a near infrared quantitative analysis model of the main quality trait of naturally air-dried single peanut and the quality selection method of the seeds relies on natural air-drying of a large sample and / or the near infrared quantitative analysis model of the main quality trait of the naturally air-dried single peanut. By the technology, high oleic acid and high oil peanut materials are identified already. Besides the selection of early generation and late generation in the breeding for quality of peanuts, the technology can be used for evaluating the quality of hybridization operation, optimizing the mutagenesis technology and controlling the quality in seed production.
Owner:SHANDONG PEANUT RES INST

Method for improving photoperiod sensitivity of tropical maize germplasm

The invention discloses a method for improving the photoperiod sensitivity of a tropical maize germplasm, and belongs to the technical field of maize genetic breeding. The method comprises the following steps: improving the photoperiod sensitivity of a world-famous tropical maize germplasm Suwan 1 by using a temperate specially-early mature flint maize LM1 of the Limagrain company in France, adopting a breeding selection method including processes of performing hybridization, mixed pollination, two-round back-crossing and continuous three-generation selfing, performing growth period and plant height selection as well as combining ability early generation test, and synchronously performing photoperiod sensitivity identification in a plurality of places in a tropical zone, a subtropical zone and a temperate zone, and especially continuously performing two rounds of back-crossing by taking the temperate specially-early mature flint maize LM1 as a back-crossing parent so as to ensure that the proportion of a temperate maize germplasm can be increased, and a maize selfing line which takes a temperate maize germplasm background as the main and integrates the tropical germplasm characteristics and temperate germplasm advantages can be obtained. By adopting the method disclosed by the invention, the problem of photoperiod sensitivity commonly existing in a process of planting the tropical maize germplasm in a temperate area can be effectively solved; and the method also has important significance in promoting the northward movement of maize varieties in the tropical zone and the subtropical zone in China.
Owner:FOOD CROPS RES INST YUNNAN ACADEMY OF AGRI SCI

Handgun slide to frame adapter

An adapter for utilizing a handgun slide manufactured for use on a common generation and version of handgun frame to make its use capable on a newer generation or versions frame having different dimensional features. The adapter makes allows use of a slide assembly comprising of a slide, barrel, recoil spring and guide from previous generations on more recent generations of the same handgun. The adapter is mounted on the previous versions dust cover creating a new geometry to allow for proper function inside the newer generation's frame. The adapter includes a bushing. The earlier generation's slides have an outer surface shape smaller than the newer generation slide with the adapter creating the geometry necessary for compatibility.
Owner:ADAMS ARMS

Cucumber powdery mildew resistance main effect QTL compact linkage molecule labeling method and applying method

InactiveCN101240342AReduce manpowerReduce the waste of equipment and material resourcesMicrobiological testing/measurementBiotechnologyEarly generation
The present invention relates to a molecular marker method closely linked with major QTL for powdery mildew of cucumber resistance, belonging to the field of biological technology. The invention comprises the following steps: hybridizing susceptible variety S94 of powdery mildew of cucumber with susceptible variety S06 of powdery mildew of cucumber, getting hybrid F1; acquiring F7 generation recombinant inbred lines by filial generation single seed descent method; separating DNA of individual cucumber leaves and performing PCR amplification; analyzing data and constructing cucumber genetic linkage map for molecular marker; applying to statistical analysis and QTL location; and determining molecular markers F, CSEPGN11, e23m18f and ME11EM9c linked with major QTL for resistance source S06 powdery mildew. The coincidence rate between the identification result of the invention and the field resistance has improved from 94 percent to 100 percent. By the molecular markers linked with major QTL for resistance source S06 powdery mildew, progeny and derived varieties thereof for the specific resistant source can be selected in early generation seedling without the influence of environment condition, saving cost and improving breeding and selection efficiency.
Owner:SHANGHAI JIAO TONG UNIV

Image processing method and apparatus

The invention discloses an image processing method and apparatus. The method comprises the steps of obtaining position information of a virtual object in an application interface currently, and querying sight line shielding data corresponding to the position information according to the position information; generating a first mask layer by the sight line shielding data according to an operation state of the virtual object in the application interface currently; in a preset unit time length, inputting the obtained first mask layer to a display unit comprising at least two mask layers, thereby replacing a second mask layer with earliest generation time in the at least two mask layers; and mixing the first mask layer and the at least two mask layers except the second mask layer in the display unit, and outputting a mixed mask layer to the application interface. By adopting the scheme, the smoothing effect of the mask layers can be achieved and the calculation load of a terminal device can be reduced.
Owner:TENCENT TECH (SHENZHEN) CO LTD

Selective breeding technique of anthocyanin type purple corn

The invention relates to a selective breeding technique of an anthocyanin type purple corn, comprising the following steps: pyramiding anthocyanin dominant genes of a plurality of locus, and enablingthe anthocyanin dominant genes of the locus to be homozygous; then pyramiding large subtending leaves, high yielding, excellent quality and adversity character and breeding purple corn or purple waxycorn inbred line which has high anthocyanin content by early generation selection and a minimally invasive single kernel identification method; and selectively breeding the anthocyanin type pure purple genotype homozygous or dominant heterozygous corn--the purple waxy corn and the purple corn by matching the purple waxy corn with the purple waxy corn, matching the purple waxy corn with the purplecorn, matching the purple corn with the purple corn or matching the purple corn with other purple recessive character corns. A prepared single cross hybrid has the advantages as follows: 1. seed cases, aleurone layers, rhachises, the subtending leaves, filaments, tassels, anthers are purple and rich in anthocyanin, and stalks, medulla, leaf veins and leaves present purple colors of different degrees and all contain the anthocyanin; 2. the single cross hybrid not only can be used for producing the anthocyanin but also can be used as a fresh food; and 3. the single cross hybrid has high yieldingand can be cultivated on all soils which are suitable for common corns.
Owner:SHENYANG AGRI UNIV

Closely interlocked molecular mark of rice new gene source-sink 1 (SS1)

The invention relates to a molecular marking method of a rice new gene source-sink 1 (SS1), and belongs to the fields of super-high-yield breeding of rice and molecular genetics. The essence of the invention is as follows: according to the interlocking separation law, an F2 secondary separation group constructed by autocopuation of a near-isogenic line carrying a SS1 heterozygous segment is takenas a test material for constructing a set of crossing and stacking system of a target segment, phenotype is further combined for performing high-precision interlocking analysis on a target gene, through two years of two-point repeated identification, the SS1 is finally precisely positioned in an interval of 55Kb on the fourth chromosome and a PCR (polymerase chain reaction)-based molecular mark FL41 which is closely interlocked with the SS1 is further obtained. Through the application of the molecular marking method in the super-high-yield breeding of rice, genotype individuals which can simultaneously affect the characters of a library (the number of grains per panicle) and a source (the flag leaf width and the leaf area) can be fast accurately identified, the early generation selection of breeding material can be performed further and the process of the super-high-yield molecular breeding of rice can be greatly accelerated.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Michelia compressa tissue culture propagation method

The invention discloses a michelia compressa tissue culture propagation method. The method includes the following steps: culturing explant plants; selecting the explants and disinfecting; culturing by an improved WPW culture medium; after cutting the treated explants, carrying out axillary bud early-generation induction culture; carrying out high voltage electrostatic field treatment; carrying out transgenerational multiplication culture; carrying out rooting induction culture; and thus successfully obtaining root-containing tissue culture seedlings by the tissue culture propagation method of the invention, wherein the proliferation multiple is 86 times, the rooting rate is 82%, the average rooting number is 3.1, and the exercising seedling survival rate reaches 90%. The method can efficiently obtain the michelia compressa seedlings, and greatly meets the demand of markets.
Owner:NANJING JINPU LANDSCAPE

Breeding method of early-ripe and disease-resistant broccolini

ActiveCN103168681ANormal inbred lineGood production capacityPlant genotype modificationEarly generationShoot
The invention relates to a breeding method of crops, and particularly to a breeding method of broccolini, belonging to the technical field of plant breeding. The breeding method has the advantages that 1. the male sterility line belongs to cytoplasmic male sterility and maternal inheritance, and is stable in sterility, the sterile plant rate and the sterility are 100 percent, nectary is developed, more nectars grow, stigma is normal, flowering and fruiting characters are good, and a seedling does not yellow under the condition of low temperature and can not deteriorate after multi-generation backcross, transform is easy, growth is vigorous, and combining ability is strong; 2. a transformation early generation sterile line is stronger in growth vigor in comparison with a maintainer line and has the advantage of interspecies cross; 3. a later producing shoot of the transformation early generation sterile line is stronger than that of the maintainer line, and thus the transformation early generation sterile line material is early planted by 5 days in comparison with a backcross male parent; 4. F1 is prepared by using the sterile line, the seed yield is high, the seed producing cost is low and the labor is saved; and 5. a new variety prepared by using the sterile line is strong in disease resistance, and is remarkable in production increasing.
Owner:安徽省凤阳县御膳油脂有限公司

Breeding and hybrid seed-producing method of onion male sterile line

InactiveCN102100175AWide range of pairing combinationsImprove economyPlant genotype modificationEarly generationAgricultural science
The invention discloses a breeding and hybrid seed-producing method of an onion male sterile line, which comprises the steps of: with a natural sterile Taiyuan red skin onion as a female parent and a fertile Taiyuan red skin onion as a male parent, hybridizing to obtain a first-filial generation; selecting a sterile plant from the first-filial generation, carrying out multi-generation continuous back crossing by using the sterile plant as a female parent and a completely-fertile Taiyuan red skin onion as a recurrent parent to breed an onion male sterile line Jin research 1A, and continuously selfing by using the completely-fertile Taiyuan red skin onion to obtain a maintainer line Jin research 1B; and with the onion male sterile line Jin research 1A as the female parent and a Shuozhou red skin onion as a restorer, hybridizing to obtain a hybrid Jin hong No 6. The breeding and hybrid seed-producing method has the advantage of wide pairing combination; the early generation has combinations with good economic characters and high sterile plant rate to be selected; the breeding process can be accelerated objectively, and the good sterile plant with the sterile plant rate being stabilized to be 100 percent and the maintainer line thereof can be bred early.
Owner:VEGETABELE INST AGRI SCI ACAD SHANXI PROV

Breeding method of novel group PLR germplasm of corn

The invention discloses a breeding method of a novel group PLR germplasm of corn. The method comprises the steps of selecting well-performing hybrids from temperate production, namely hybrid F1-F2 generation germplasms in the modes of Reid*PB group and Reid*Lan., respectively breeding selfing lines and measuring combining ability; and constructing the PLR group germplasm by utilizing the R / P and R / L selfing lines with high combining ability and complementary agronomic traits. The method has the beneficial effects that the early generation selection and the S3-S4 generation haploid breeding areadopted; according to the method, the plant type, the resistance, the panicle traits and the like are strictly selected in flowering and harvesting periods and a batch of excellent selfing lines arebred; barren ear tips are reduced; the resistance, the combining ability, the tip sealing property, the seed-producing rate, the dehydration property and the adaptability are increased; and the prepared hybrids can meet the production requirements.
Owner:贵州省旱粮研究所

Closely linked molecular marker for novel gene (SS2) of rice sink source

The invention relates to a closely linked molecular marker for a novel gene (SS2) of a rice sink source and belongs to the fields of super-high-yield breeding of rice and molecular genetics. The invention aims at constructing a set of contig system of a target segment by using an F2 secondary separation group constructed by selfing a near-isogenic line carrying an SS2 heterozygous segment as a testing piece according to the linked separation rule; high-precision linked analysis for a target gene is carried out by combining with a phenotype; after two-point repeated identification for two years, the SS2 is finally and finely positioned in an interval of 104Kb on the 3rd chromosome, and a molecular marker SL14 based on a PCR (Polymerase Chain Reaction) closely linked with the SS2 is obtained. The closely linked molecular marker disclosed by the invention is applied to super-high-yield breeding of the rice, so that a genotype individium for simultaneously influencing the sink (the numberof grain per ear) and source (the length of sword leaves) characters can be quickly and accurately identified; the early generation selection of a breeding material is carried out; and the progress of the super-high-yield breeding of the rice is accelerated.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

Technical method for quickly identifying drought resistance of wheat by using near-infrared spectroscopy

InactiveCN103353445AScreening large scaleMass screeningColor/spectral properties measurementsEarly generationAgricultural science
The invention mainly relates to a technical method for quickly identifying the drought resistance of wheat by using a near-infrared spectroscopy. The technical method comprises the following steps: A, selecting representative wheat grain samples distributed on all drought resistance grades as a sample calibration set, B, determining the drought resistance indexes of all the wheat grain samples in the sample calibration set through adopting a wheat drought resistance identification method in the national standard method, C, collecting near infrared spectrums of the sample calibration set and determining a mathematical model, and D, detecting to-be-tested samples. The mathematical model for screening and identifying wheat drought resistance materials is established through using the difference on the near infrared spectrums of the wheat grains of the same drought resistance type, the reliability and the applicability are high, the technical method is not limited by the period, so that identification is carried out at any moment; in addition, the technical method is also not limited by the quantity, thereby screening drought resistance resources simply, conveniently and efficiently on a large scale, and the drought resistance identification to the early generation and high generation materials of the wheat can be performed quickly, losslessly and efficiently.
Owner:LUOYANG ACADEMY OF AGRI & FORESTRY SCI

Color display converter for pinball machines

A later generation display device may be connected to the video output port of an older electronic device which utilized an earlier generation display such as a dot matrix display. The early generation display is replaced with the later generation display. The display device includes software which receives graphic data through the video output port and identifies which frame is currently being streamed. The display device matches the frame being streamed to a stored graphic frame having a higher resolution and / or color. The matched frame is delivered to the later generation device so that the user can experience a higher quality visual effect by retrofitting the older electronic device with the later generation display.
Owner:PERLOW RANDALL BRET

Molecular marker for assistant breeding of bacterial blight resistant gene Xa21 and application of molecular marker

The invention provides a molecular marker for assistant breeding of a bacterial blight resistant gene Xa21. The molecular marker is an SNP marker RSXA211110 co-separated with the rice bacterial blight resistant gene Xa21, and the SNP marker detects the 20894905-position base of chromosome 11 of rice; primers developed on the basis of aKASPtechnology comprise a specific primer X, a specific primer Y and a universal primer C, and sequences of the primers are shown as SEQ ID NO:1-3. The invention further provides an application of the SNP marker RSXA211110 to assistant breeding of the bacterial blight resistant gene Xa21. The application has the advantages of being simple to operate, low in cost and short in period, the marker is good in stability and is not affected by other gene effects and environmental factors, selection in early generation can be realized, the breeding period is shortened, the breeding efficiency is increased, and the molecular marker has great significance in improvement of bacterial blight resistant rice breeds and is suitable for assistant selective breeding of the gene Xa21.
Owner:HUAZHI RICE BIO TECH CO LTD

Specific rice high-resistance bacterial leaf blight gene marker and application thereof

The invention discloses a specific rice high-resistance bacterial leaf blight gene marker which is Xa7GSM, and the corresponding nucleotide sequence of the marker is SEQ ID NO:1. The invention further discloses primers used for PCR amplification, and the primers comprise a positive primer 5'-CCTGCTCGAGCTAATCCAAATC 3', and a reverse primer 5'GATACTGTCATTCTTCACGGTCTG 3'. The application of the specific rice high-resistance bacterial leaf blight gene marker comprises assistant selective breeding of a rice Xa7 gene, or application of cloning the Xa7 gene. The specific rice high-resistance bacterial leaf blight gene marker has the advantages of simplicity in operation, low cost and short period, is good in stability, is not affected by other gene effects or environment factors, and is applicable to popularization and application, early-generation selection can be achieved, the breeding cycle can be shortened, and the breeding efficiency can be improved.
Owner:ZHEJIANG NORMAL UNIVERSITY

Detoxicating agent on tobacco deformity induced by quinclorac and applying method thereof

The invention relates to a detoxicating agent on tobacco deformity induced by quinclorac and an applying method thereof. The detoxicating agent is prepared from the following materials: 0.4%-0.6% of natural plant growth regulator, 3.6%-9.0% of plant microecology agent, 13.3%-31.6% of tobacco leaf nutrient and 61.3%-81.9% of efficiency enhancer. The applying method of the detoxicating agent comprises the following steps of: using 35-75 times of clean water to dilute 500g-900g of detoxicating agent for every 1000 tobacco plants, and uniformly spraying onto the tobacco plants and the positive and reverse surfaces of the tobacco leaves until the wet dew on the leaf surface has no water dripping in the early generation period of tobacco deformity induced by quinclorac. The invention obviously increases the leaf length of the tobacco leaf deformity induced by quinclorac, obviously increases the leaf width and total sugar, obviously decreases the nicotine, effectively removes the symptom of the tobacco leaf deformity induced by quinclorac, enables the tobaccom leaf to obviously recover the normal botany property and internal chemical quality, and has the advantages of strong compounding property of raw materials, simple preparation, high safety, strong point and high practical value in the tobacco leaf production.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Chicken C-type acian metapneumovirus strain(aMPV-JCX) and application thereof

The invention provides a chicken C-type acian metapneumovirus strain(aMPV-JCX) and application thereof. The preservation number of the aMPV / C-JCX strain is CGMCC No.10900. The virus is a cell culture adaptive strain, a preparation method of the cell culture adaptive strain comprises the steps that tissue grinding fluid of a sick chicken infected by aMPV / C-JCX which is firstly obtained through separation domestically is collected to be inoculated into single-layer Vero cells which grow being adherent to the wall, a cell culture serves as an inoculum for the next round of passage, sequentially continuous passage is conducted, and the cell culture adaptive strain is obtained. In the adaptive process, the early-generation culture cycle is 7-9 days, the culture cycle is shortened to 3-5 days when the 60th generation is cultured, and an obvious cytopathic effect can be observed. It is verified through a transmission electron microscope, indirect immunofluorescence and a western-blotting method that the aMPV / C-JCX can be effectively cultured. The titer 1 g TCID50 of the virus is equal to 10<-4.2> / 0.1 ml. It is verified through SPF chickens that the virus virulence is weak, good immunogenicity and protectiveness are achieved, and the cell-adapted virus is an ideal candidate strain for researching and producing viral vaccine.
Owner:BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES

Method for selectively breeding wheat-rye 1BL/1RS translocation lines

InactiveCN101611694AIncrease selection frequencyCompact plantPlant genotype modificationEarly generationDisease
The invention relates to a method for selectively breeding wheat-rye 1BL / 1RS translocation lines. The method comprises: selecting Blue Black No.1 as a female parent and common wheat as a male parent, performing hybridization and obtaining a first hybrid generation; taking the first hybrid generation as the female parent and the common wheat as the male parent, performing composite hybridization and obtaining a second hybrid generation; sparsely sowing the second hybrid generation, selecting single plants with the excellent shape and properties of wheat and rye and obtaining third-generation strains; selecting the single plants with the excellent shape and properties of the Blue Black No.1 from the third-generation strains, identifying chromosomal structure, obtaining wheat-rye 1BL / 1RS translocation-line plants, performing anther culture and obtaining early-generation strains; and identifying the yield, quality and resistance of the early-generation lines and accelerating the propagation of the strains with good yield, quality and resistance. The method has the advantages of recombining excellent genes 1B / 1R on different sites to re-synthesize a novel 1BL / 1RS translocation line, improving selection frequency and obtaining an excellent wheat variety with high yield, high quality, disease resistance, lodging resistance and wide adaptability.
Owner:沈天民

Sterile cultivation method of mealworms

The invention relates to a sterile cultivation method of mealworms. The operation steps mainly comprise processing of early generation mealworm materials, preparation of sterile bran culture media, sterile cultivation of the mealworms, and detection of sterile imagoes and quantity statistics. Through using of the provided sterile cultivation method of the mealworms, purposes that imago bodies do not carry germs, and the mealworms grow healthily and strongly are achieved. The sterile cultivation method of the mealworms is easy and convenient to operate, good in effects, and capable of being applied to material drawing experiments of sterile materials each stage of the life history of the mealworms.
Owner:BAOSHAN UNIV