Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific rice high-resistance bacterial leaf blight gene marker and application thereof

A bacterial blight and specific technology, which is applied in the field of molecular genetic breeding, can solve the problems of hybrid rice resistance and durability can not be guaranteed, and achieve the effect of improving breeding efficiency, good stability, and short cycle

Inactive Publication Date: 2015-08-05
ZHEJIANG NORMAL UNIVERSITY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the hybrid rice grown on a large scale in China contains the Xa4 gene, but the long-term and large-scale use of a single resistance source has led to the evolution of new pathogenic strains, and the persistence of disease resistance in hybrid rice cannot be guaranteed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific rice high-resistance bacterial leaf blight gene marker and application thereof
  • Specific rice high-resistance bacterial leaf blight gene marker and application thereof
  • Specific rice high-resistance bacterial leaf blight gene marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Primer synthesis: Entrust Life Technologies to synthesize Xa7GSM-labeled primers. The primer sequence is:

[0030] 5'CCTGCTCGAGCTAATCCAATC 3' and 5'GATACTGTCATTCTTCACGGTCTG 3'.

[0031] 2. DNA extraction: use rice leaves as materials to extract genomic DNA. There are many DNA extraction methods reported, and one can be selected arbitrarily. This case uses the report by Panaud et al. (Mol Gen Genet, 1996, 252:597-607) Methods.

[0032] 3. PCR amplification: In a 0.2ml thin-walled tube dedicated to PCR amplification, add 20ng of rice DNA, 0.25μM each of the two primers, 2×Taq PCR Master Mix (TIANGEN company), use ddH 2 O dilute to 20μl, mix thoroughly. PCR amplification was carried out on a thermal cycler, and the amplification conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, 35 cycles; extension at 72°C for 5 minutes. The thermal cycler used in the prese...

Embodiment 2

[0042] It is known that the male restorer line "Miryang 46", which is the main hybrid rice planted in Zhejiang Province, does not contain the Xa7 gene ( image 3 ), less resistant to bacterial blight ( Figure 4 ). In order to improve the disease resistance of this rice variety, the inventors crossed IRBB7 with "Miryang 46", and obtained F 1 Dai then conducted multiple backcrosses with “Miryang 46”. However, after each backcross, only a part of the individual plants carry the Xa7 gene, and the individual plants containing the Xa7 gene must be selected for further backcrossing, so as to ensure that the Xa7 gene will not be lost in the long-term breeding. Therefore, each generation of plants was detected by using the marker Xa7GSM of the present invention, and a single plant amplified with a 315bp band, that is, a plant containing the Xa7 gene, was selected for the next round of backcrossing, and the Xa7 gene was successfully transferred In the rice "Miryang 46" ( image 3 )...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific rice high-resistance bacterial leaf blight gene marker which is Xa7GSM, and the corresponding nucleotide sequence of the marker is SEQ ID NO:1. The invention further discloses primers used for PCR amplification, and the primers comprise a positive primer 5'-CCTGCTCGAGCTAATCCAAATC 3', and a reverse primer 5'GATACTGTCATTCTTCACGGTCTG 3'. The application of the specific rice high-resistance bacterial leaf blight gene marker comprises assistant selective breeding of a rice Xa7 gene, or application of cloning the Xa7 gene. The specific rice high-resistance bacterial leaf blight gene marker has the advantages of simplicity in operation, low cost and short period, is good in stability, is not affected by other gene effects or environment factors, and is applicable to popularization and application, early-generation selection can be achieved, the breeding cycle can be shortened, and the breeding efficiency can be improved.

Description

technical field [0001] The invention relates to a DNA marker of a high-efficiency rice bacterial blight-resistant gene and its application in breeding, belonging to the field of molecular genetic breeding. Background technique [0002] Rice bacterial blight is a worldwide bacterial disease caused by Gram-negative Xanthomonas oryzae pv.Oryzae, Xoo. It is called rice together with rice blast and sheath blight The "three major diseases". When rice suffers from bacterial blight, the yield is generally reduced by 20-30%, and in severe cases it can reach 50%, or even no harvest. Discovering and utilizing disease-resistant genes is the most effective way to control rice bacterial blight. So far, nearly 40 bacterial blight resistance genes have been identified in rice internationally (National Rice Data Center http: / / www.ricedata.cn), but only a few of them have full-growth, broad-spectrum, long-lasting There are not many genes that can be effectively used in rice breeding and pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 马伯军赵倩倩蒋宝琳王欧陈析丰
Owner ZHEJIANG NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com