Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1
A rice, gene technology, applied in the field of plant genetic engineering and biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Phenotypic analysis of wild type and mutants
[0040] Measure the plant height at the mature stage, the method is to measure with a ruler from the top of the ear to the bottom node; the number of tillers is the effective number of tillers at the mature stage; The value measured at the widest point of the spike blade. 25 individual plants were measured for each agronomic trait. The average value was calculated according to the measured values, and the P value was calculated by t test. The results are shown in Table 1.
[0041] The results showed that compared with the wild type, the mutant had a significantly reduced plant height, a significantly reduced number of tillers, and a significantly smaller length and width of flag leaves.
[0042] Table 1. Comparison of agronomic traits between wild type and mutants (2014, Beijing)
[0043]
[0044] Example: 2: PALS1 gene cloning
[0045] 1. pals1 Mutant source:
[0046] Rice ( Oryza sativa L. )mut...
Embodiment 3
[0060] Example 3: PALS1 transgene verification
[0061] 1. Construction of interference vectors
[0062] because PALS1 The full length of the genome is 13848 bp, and it is difficult to construct a complementary vector. Therefore, the inventors used the pLHRNAi interference carrier (authorized announcement number: CN102191262B; application number: 201110055864.X; invention name: an RNA interference carrier and its application) as a backbone to construct interference PALS1 Gene binary expression vectors for transgenic verification. The conserved sequence of the 346 bp gene in the CDS 1040-1385 interval of the PALS1 gene was selected as the specific interference region, and cDNA was used as the template for amplification. The primers for fragment amplification connected to the left multiple cloning site are: 5' TTCTGCACTAGGTACCAGGCCTGTTGATCGCATCCTAGGCTGTC 3' (1-23 is the vector sequence, 24-44 is the gene sequence) and 5' CTGACGTAGGGGCGATAGAGCTCGTGACGATTTGATCAGCGGAA 3' (1-23...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com