Rice leaf width molecular marker FLW-7 and application thereof

A technology of FLW-7 and molecular markers, which is applied in the field of agricultural biotechnology engineering, can solve the problems of affecting the development and distribution of vascular tissues, the decline of auxin polar transport capacity, etc., to overcome the long time period, improve efficiency, and increase the number of leaves The effect of width

Active Publication Date: 2014-08-27
CHINA NAT RICE RES INST
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mutation of this gene reduces the polar transport capacity of auxin, which in turn affects the development and distribution of vascular tissue

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice leaf width molecular marker FLW-7 and application thereof
  • Rice leaf width molecular marker FLW-7 and application thereof
  • Rice leaf width molecular marker FLW-7 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1. Using STS marker FLW-7 to identify polymorphisms of rice leaf width Peiai 64S and broad-leaved indica rice 93-11

[0061] The specific method is: select the rice materials Peiai 64S and Kuanye 93-11 from the germplasm resource bank of the China Rice Research Institute, and use the hybridization of Peiai 64S and Kuanye 93-11 to obtain the F1, and use the primer FLW-7 to identify its multiple attitude ( figure 1 ).

[0062] 1. DNA extraction

[0063] 1) Prepare DNA extraction buffer:

[0064] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005M EDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA ; 2M NaCl; 0.055M CTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to prepare DNA Extraction buffer; final concentration of sodium bisulfite in DNA extraction buffer is 0....

Embodiment 2

[0084] Example 2. Using STS molecular marker FLW-7 to identify sequence differences between the narrow-leaf variety Peiai 64S and the broad-leaf indica rice 93-11

[0085] The specific method is: use the STS molecular marker FLW-7 to perform PCR amplification on the genomic DNA of Peiai 64S and 93-11, entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare the differences in their sequences ( figure 2 ).

[0086] 1. DNA extraction

[0087] With embodiment 1.

[0088] 2. PCR amplification

[0089] With embodiment 1.

[0090] 3. Recovery of PCR products

[0091] The recovery of PCR products was carried out by using the PCR product recovery kit (spin column type, catalog number: DP1403) developed by Beijing Biotek Biotechnology Co., Ltd., according to the requirements of the product instructions, and the recovered PCR products were entrusted to Shanghai Yingjun Biotechnology Co., Ltd. for sequencing .

[0092] according to figure ...

Embodiment 3

[0093] Example 3. Using the STS marker FLW-7 to carry out assisted selection breeding of broad-leaf rice

[0094] The specific method is: the wide-leaf donor parent variety 93-11 and the narrow-leaf parent Pei'ai 64S are sequentially crossed, backcrossed and selfed, and the resulting progeny is assisted with the molecular marker FLW-7, and the band type and 93-11 single plant with the same belt pattern was used for breeding improvement.

[0095] 1. DNA extraction

[0096] With embodiment 1.

[0097] 2. STS marker detection

[0098] 1), PCR amplification

[0099] Same as Step 2 of Example 1.

[0100] 2), electrophoresis detection

[0101] Same as Step 3 of Example 1.

[0102] 3. STS molecular marker FLW-7 for assisted selection breeding of rice leaf shape

[0103] The wide-leaf donor parent indica rice variety 93-11 was crossed, backcrossed and selfed with the narrow-leaf variety Pei'ai 64S, combined with the assisted selection of the molecular marker FLW-7, and the band...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker FLW-7 of a nucleotide sequence of rice LOC_07g1200 of rice. With the rice as a species, a molecular marker primer is selected from primer pairs as shown in the specification, wherein the nucleotide sequence is 5'->3', FLW-7, forward: TGGGTGCTTCTTTTGTGGGA; reverse: TGCAGTTGTGAAGAAGTGGAGA. The invention also provides a method for developing the molecular marker FLW-7. The molecular marker FLW-7 disclosed by the invention is applied to identification of the width of the leaves of rice three-leaf stage and / or the assisted selection breeding of progeny broad-leaf plants. Specifically, when the progenies of Pei'ai 64S and Yangdao 6 are screened, an individual plant with the same banding pattern as the banding pattern of Yangdao 6 in progenies is selected for breeding a broad-leaf plant type.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker related to rice leaf width and its obtaining method and application. Background technique [0002] Leaves are the direct organs of plants for photosynthesis and transpiration. Plants perform photosynthesis through their leaves, transforming light energy into chemical energy necessary for plant growth and development. It is the source of life for all animals on the earth, and also the main source of material and energy for human society. [1] . Leaves can also promote the transportation of water, nutrients and minerals in the plant through transpiration [2] . Rice leaves are the "source" organs of rice production and output of assimilated products, which play an important role in the normal operation of life activities. Leaf shape is the main factor affecting plant type. In recent years, in the field of rice breeding, many breeders have pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor张光恒钱前王莉曾大力胡江朱丽高振宇徐杰郭龙彪董国军任德勇颜美仙
OwnerCHINA NAT RICE RES INST