Gene ZmNL4 for controlling corn leaf width and application thereof

A maize leaf and maize technology, applied in the field of molecular genetics, can solve the problem of not yet clearly controlling the main function gene of maize leaf width and the like

Active Publication Date: 2018-06-15
未米生物科技(海南)有限公司
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above studies only predicted the candidate genes but did not carry out functional verification, or the main functional genes controlling maize leaf width have not been clearly identified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene ZmNL4 for controlling corn leaf width and application thereof
  • Gene ZmNL4 for controlling corn leaf width and application thereof
  • Gene ZmNL4 for controlling corn leaf width and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] The structure of embodiment 1ZmNL4 gene and InDel functional site

[0061] The functional gene ZmNL4 controlling maize leaf width, numbered GRMZM2G070553, is located at chr4: 3,464,429-3,471,840, with a total length of 7,412bp and 16 exons. The length of the coding region is 2153bp. Its genetic structure is as figure 1 As shown in A. Exon 14 of the ZmNL4 gene has a molecular marker highly correlated with leaf width phenotypic variation, which is located at the 6,606th base of SEQID NO.1 (ie chr4: 3465235), which is a 1bp indel (InDel_1 / 0)( figure 1 A). Wherein, the sequence of the InDel_0 genotype is shown in SEQ ID NO.1; the sequence of the InDel_1 genotype is shown in SEQ ID NO.2. By Sanger sequencing, comparing 70 population materials from different genetic backgrounds, it was found that the leaf width of maize materials with InDel_1 was significantly smaller than that of InDel_0 maize materials (Table 1). The results showed that InDel_1 / 0 located at the 6,606b...

Embodiment 2

[0065] Example 2 Development of Molecular Markers Based on InDel Sites

[0066] Competitive allele-specific PCR (KompetitiveAlell Specific PCR) primers, referred to as KASP primers, were designed according to the InDel functional sites described in Example 1. Include the forward primer G0553-K1F (SEQ ID NO.5): gaaggtgaccaagttcatgctGTGGCGCTGGAAGAGCAGCT for detecting the InDel_0 marker site, wherein gaaggtgaccaagttcatgct is the nucleotide sequence of the FAM tag; G0553-K2F (SEQ ID NO.6): gaaggtcggagtcaacggattGTGGCGCTGGAAGAGCAGCG To detect the InDel_1 marker site, wherein gaaggtcggagtcaacggatt is the nucleotide sequence of the HEX tag; reverse primer: G0553-KR (SEQ ID NO.7): GTCGATGACCAGGGACAGGTTC.

[0067] The utility of molecular markers was evaluated by the association analysis between different genotypes and maize leaf width traits.

[0068] 1. Extract the genomic DNA of the corn to be tested. The specific process is as follows:

[0069] (1) Take an appropriate amount of l...

Embodiment 3

[0084] Embodiment 3 ZmNL4 protein structure and identity protein thereof

[0085] Further analysis of the protein sequence encoded by the ZmNL4 gene found that the gene encodes a total of 716 amino acids (sequence shown in SEQ ID NO.8), and its protein has two functional domains, namely KELCH-domain and BAP-domain ( figure 1 B). There is an allele InDel_1 genotype with a 1bp deletion, which leads to a frameshift mutation at position 566 and early termination of protein coding, resulting in a truncated protein with only 603 amino acids (sequence shown in SEQ ID NO.9). The short protein contains a KELCH-domain and a very small part of the BAP-domain. It can be seen that the deletion of the BAP domain has an important impact on protein function and may lead to variation in leaf phenotypes. Further use of the BLASTP tool in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) found that the protein encoded by the ZmNL4 gene was expressed in sorghum, millet, millet, palmarosa, Brach...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular genetics, and particularly relates to a gene ZmNL4 for controlling corn leaf width and application of a related molecular marker to screening or improvement of a plant leaf width trait. The invention provides a sequence of the gene ZmNL4 for controlling the corn leaf width, and discloses an InDel locus significantly associated with the corn leaf width trait inside the ZDNL4 gene. The invention discloses a method for screening the corn leaf width trait by using the molecular marker developed on the basis of the InDel locus. Furthermore, the invention discloses a method for mutating ZmNL4 protein or identity protein thereof by genetic engineering means to reduce the plant leaf width.

Description

technical field [0001] The present invention belongs to the field of molecular genetics. It specifically relates to the application of the gene ZmNL4 controlling maize leaf width and its related molecular markers in screening or improving plant leaf width traits. The invention provides a sequence controlling the gene ZmNL4 of maize leaf width, and discloses an InDel site in the ZmNL4 gene which is significantly related to the trait of maize leaf width. The invention discloses a method for screening the leaf width traits of maize by using the molecular marker developed based on the InDel site. Furthermore, the present invention discloses a method for reducing plant leaf width by mutating the ZmNL4 protein or its homologous protein by means of genetic engineering. Background technique [0002] In recent years, the direction of maize breeding has gradually shifted from the pursuit of single plant yield to population yield. Therefore, compact maize varieties are becoming more ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/12A01H6/46C12Q1/6895C12N15/11
CPCC07K14/415C12N15/8213C12N15/8261C12Q1/6895C12Q2600/13C12Q2600/156
Inventor严建兵王夏青
Owner未米生物科技(海南)有限公司