Preparation and application of peptidoglycan recognition protein from whitefly tabaci with bactericidal activity
A technology for identifying proteins and bactericidal activity, applied in the fields of molecular biology and genetic engineering, to solve problems such as plant withering, crop yield reduction or failure, and plant virus disease pandemics.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment example 1
[0031] Implementation Case 1: Full-length cDNA Cloning of Bemis tabaci Peptidoglycan Recognition Protein BtPGRP Gene
[0032] 1.1, TRIzol method to extract total RNA
[0033] (1) Freeze a certain amount (about 200 Bemisia tabaci) for 1 min, put it into a 1.5 ml centrifuge tube, add 1 ml TRIzol reagent, thoroughly grind and homogenate, and let stand at room temperature for 5 min.
[0034] (2) Add 0.2ml chloroform to the centrifuge tube, shake for 15s, transfer the mixture into a TIANGEN centrifuge tube, and let stand for 2min.
[0035] (3) Centrifuge at 12000g for 15min at 4°C, take the supernatant, and transfer it to a new 1.5ml centrifuge tube.
[0036] (4) Add 0.5ml of isopropanol to the centrifuge tube, mix the liquid in the tube gently, and let stand at room temperature for 10 minutes.
[0037] (5) Centrifuge at 12000 g for 10 min at 4°C, and discard the supernatant.
[0038] (6) Add 1ml of 75% ethanol to the centrifuge tube, gently wash the precipitate, centrifuge at 7...
Embodiment 2
[0056] Example 2: Construction, expression and functional activity determination of the whitefly peptidoglycan recognition protein BtPGRP expression vector
[0057] 2.1. Expression vector construction
[0058] (1) According to the sequence of the whitefly peptidoglycan recognition protein BtPGRP and the cloning site of the expression vector pET-28a (Novagen Company), design primers: PGRP-BamH:CG GGATCC ATTGAGGGTCGCCGAGATTCGTGGTACG (underlined BamH I site); PGRP-Hind III: CCC AAGCTT CTATTCGACGAGGAGGGCGAG (the Hind III site is underlined).
[0059] (2) Gene amplification, cloning and recombinant plasmid screening
[0060] Using the whitefly dsDNA as a template, the PCR reaction was carried out with the above primers. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 15s, 63°C, 30s, 72°C, 45s, 35 cycles; 72°C, 6min extension .
[0061] Take 2 μl of PCR products, and after detection by 1% agarose gel electrophoresis, the Clean UP kit cleans and recovers t...
Embodiment 3
[0078] Example 3: Analysis of Bacteria Recognition Activity of Bemisia tabaci Peptidoglycan Recognition Protein BtPGRP Prokaryotic Recombinant Protein
[0079] 1) Take Escherichia coli, Staphylococcus aureus and Candida albicans in the logarithmic phase of growth, centrifuge at 3500rpm to remove the supernatant, wash with PBS three times, 5 minutes each time.
[0080] 2) Suspend the bacterial liquid with 40 μl of the purified target protein, let it stand at room temperature for 10 minutes, and centrifuge to remove the upper phase.
[0081] 3) Fixative cold acetone fixed bacterial solution, 2min.
[0082] 4) Wash with PBS three times, 5 minutes each time. 5% BSA blocked for 1h.
[0083] 5) Wash once with PBS, and incubate for 1 hour with BtPGRP antibody in buffer with 0.5% BSA at a ratio of 1:500 (V / V).
[0084] 6) Wash three times with PBS, 5 minutes each time, and incubate for 1 hour with fluorescent immune antibody 1:400 PBS buffer.
[0085] Wash five times with PBS, 5 m...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More