Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Agrobacterium-mediated Zizania smut transformant strain and its preparation method and application

An Agrobacterium-mediated, black powder technology, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., can solve the problems of cumbersome operation, low transformation efficiency, and high false positives, and achieve a simple source of receptors. , the effect of high conversion efficiency

Inactive Publication Date: 2018-03-23
ZHEJIANG FORESTRY ACAD +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process of protoplast preparation and regeneration is complex and poorly reproducible, which causes PEG-CaC1 2 The method is cumbersome to operate and the conversion efficiency is low
Although electroporation and biolistic methods can use conidia as receptors, the transformation efficiency of these methods is also very low
REMI is a technology that randomly inserts linearized plasmid DNA into the genome DNA of an organism to generate insertion mutations, but 30%-50% of the mutants produced by this technology are not caused by insertion mutations, and the false positives are high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium-mediated Zizania smut transformant strain and its preparation method and application
  • Agrobacterium-mediated Zizania smut transformant strain and its preparation method and application
  • Agrobacterium-mediated Zizania smut transformant strain and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 carrier system construction

[0054] Plant expression vectors generally cannot be directly used in fungi, because usually the promoters required for plant gene expression have problems in terms of their efficiency and expression stability in fungi. At present, there are few vectors that can be directly used in fungi, so the present invention transforms the plant pCAMBIA1301 expression vector to transgene the Zizania smut. The main transformation of the vector is firstly, replacing the 35S promoter in the plant expression vector with the gpda promoter and hsp70 promoter from Aspergillus nidulans; secondly, inserting the sGFP reporter gene suitable for the fungal system to facilitate subsequent expression detection; thirdly, providing multiple For antibiotic selection, the present invention mainly includes the hygromycin resistance gene hyg, which can be effectively screened with hygromycin, and the neomycin phosphotransferase II site, which can be screened with...

Embodiment 2

[0061] Example 2 Carrier system construction

[0062] We also used the pPK2 vector different from pCAMBIA1301 as the backbone, through the homologous recombination method of Infusion (that is, Clontech's In-Fusion technology, as long as the end of the inserted DNA fragment has 15 homologous base sequences with the end of the vector, cloning recombination can be completed ) to insert various target fragments to construct the required expression vector. Specific steps are as follows:

[0063] 1) Using the fungal expression vector constructed by pCAMBIA1301, the EcoRI-Pgpda-SacI-GFP-PstI-Ttrpc-HindIII fragment was amplified with high-fidelity Taq enzyme (primers used were PgpdaF02: GAATTCCGGAGAATATGGAGCTTCATCG, TtrpcR: AAGCTTTCGAGTGGAGATGTGGAGTG), the fragment It can be combined with the pmd-19T simple vector as an intermediate vector, marked as T-Pgpda-sgfp;

[0064] 2) For fungal promoters to be replaced, such as the heat shock protein promoter Phsp70 from the carbon source-c...

Embodiment 3

[0071] Embodiment 3 Agrobacterium system preparation

[0072] 1. Preparation of Competent State

[0073] (1) Streak the glycerol strain (GV3101 or EHA105) stored at -80°C on an LB (50mg / LRif) plate, and culture it overnight at 28°C for activation;

[0074] (2) Select the single clone on the plate, transfer it to a 5ml LB (50mg / L Rif) tube and shake the bacteria overnight;

[0075] (3) Transfer 5ml of the small shaker solution to a 100ml LB shaker bottle, shake and culture at 250rpm at 28°C for 4-5 hours, and measure the OD of the bacteria solution regularly 600 Value, measured every 30min after culturing for 2 hours, when OD 600 When the value reaches 0.3-0.4, take out the shaker flask from the shaker and place it on ice to fully cool (usually about 30 minutes);

[0076] (4) The bacterial solution was transferred to a pre-cooled 50ml centrifuge tube, and centrifuged at 4°C and below 4000g for 15 minutes. Carefully pour off the supernatant, wash the resuspended bacteria with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biological breeding, in particular to an Agrobacterium-mediated Ustilago esculenta transformant strain and a preparation method and application thereof. Agrobacterium mediates the transformant strain of Ustilago esculenta, and the Agrobacterium infection receptor of the transformant strain is Ustilago esculenta. A method for preparing the above-mentioned Agrobacterium-mediated transformation of Zizania smut transformant strain, the steps are as follows: 1) Preparation of fungal expression vector; 2) Preparation of Agrobacterium competent; 3) Electrotransformation of Agrobacterium; 4) Agrobacterium-mediated transformation Guided transformation to obtain the transformant. The present invention does not need to prepare complex protoplasts, the source of the receptor is simple, and the spores and hyphae of the fungus can be directly used for transformation; the transformation efficiency is high; in addition, the single-copy ratio of the obtained transformants is relatively large, which is beneficial to obtain marker genes .

Description

technical field [0001] The invention relates to the field of biological breeding, in particular to an Agrobacterium-mediated Ustilagoesculenta transformant strain and a preparation method and application thereof. Background technique [0002] Zizania is a unique aquatic vegetable in my country, which is planted in most provinces of China, and the economic benefits of production are very high. Zizania as a vegetable is mainly infected by Ustilago esculenta and swells into a fleshy stem. Existing studies have shown that in nature, the frequency of plant budding is very low, while Zizania can isolate many large stable variations in a small population. Therefore, although the current mechanism of smut infection It has not been fully elucidated, but it can be speculated that the variation of Zizania stems mainly not from the budding of Zizania plants, but from the genetic variation of Zizania smut. [0003] It is generally believed that smut is an important plant pathogen, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/15C12N15/80C12N15/66C12Q1/686C12Q1/04C12R1/645
CPCA01H5/00C12N1/14C12N15/66C12N15/80C12Q1/04C12N1/145C12R2001/645
Inventor 彭华正韩凝金群英边红武朱汤军钱佳
Owner ZHEJIANG FORESTRY ACAD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More