Target sequence and detection kit for detecting Mycoplasma pneumoniae
A Mycoplasma pneumoniae and kit technology, applied in the field of molecular biology, can solve problems such as the difficulty of designing probe primers
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Screening and Determination of Specific Repeated Sequences for Detection of Mycoplasma pneumoniae
[0036] Select 20 domestic clinical isolates of Mycoplasma pneumoniae of different types for enrichment culture, and extract the DNA of the whole bacteria. After the concentration measurement, use the Illumina Hiseq 2000 sequencer to perform whole genome sequencing, and obtain the drafts of the whole genome of 20 strains of Mycoplasma pneumoniae. The sequenced strains were compared with the known RepMP repeat sequences in the NCBI database using Vector NTI Suite 6 software to find out the conserved regions. A 92bp nucleotide conservation region in the RepMP23 repeat sequence was found, and its nucleotide sequence is shown in SEQ ID NO.1, which corresponds to nt170-261 in the RepMP23-a sequence and corresponds to nt161- in the RepMP23-b sequence 252, corresponding to nt468-559 in the RepMP23-d sequence, corresponding to nt177-268 in the RepMP23-e sequence, corresp...
Embodiment 2
[0037] Example 2 Primers and probes for detecting specific repeat sequences of Mycoplasma pneumoniae
[0038] For the target sequence used to amplify Mycoplasma pneumoniae determined in Example 1, the inventor designed many sets of primer and probe combinations. Through experimental comparison, it was found that the fluorescence signal value of the following primer and probe combinations exceeded 11,000, and the annealing temperature was 55 The detection ct value between ℃-59 ℃ is the smallest, so the present invention determines that the combination of primers and probes is the best combination for fluorescent quantitative PCR detection of Mycoplasma pneumoniae.
[0039] RepMP23-F1:GTG(G / A)ATGATATAACCGCGCC (SEQ ID NO.2)
[0040] RepMP23-R1:GAACGCGAACCACTTGTGTTC (SEQ ID NO.3)
[0041] RepMP23-MGB-P1:FAM-TCGTCCAGCGGAAC-BHQ1 (SEQ ID NO.4)
Embodiment 3
[0042] Example 3 Optimization of Experimental Parameters and Method Establishment for Detection of Mycoplasma pneumoniae by Real-time Fluorescent Quantitative PCR
[0043] (1) Optimization of magnesium ion concentration in the system: MgCl in the system 2 Increase from 0.5 μl to 4 μl successively, each increment of 0.5 μl, and make 3 parallel samples for each concentration gradient. ResultMgCl 2 The amount added is 1 μl (MgCl 2 When the final concentration is 3mM), the amplification effect of the system is the best.
[0044] (2) Optimization of the annealing temperature of the system: the annealing temperature of the system was changed from 55°C to 65°C, and the results showed that the amplification effect of the system was the best when the annealing temperature was 56-59°C.
[0045] (3) Optimization of MpP1 real-time fluorescent quantitative PCR amplification system and amplification conditions
[0046]
[0047] Amplification conditions: pre-denaturation at 95°C for 2...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


