Unlock instant, AI-driven research and patent intelligence for your innovation.

An immunoprotective Acinetobacter baumannii surface antigen Sura1

A technology of Acinetobacter baumannii and protective antigen, which is applied in the field of identification of immunoprotective antigens of Acinetobacter baumannii, can solve the problems of unclear biological functions of proteins, and achieve the effect of effective immune protection

Active Publication Date: 2017-08-25
JILIN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Many surface proteins of Acinetobacter baumannii have been identified as protective antigen molecules. However, because the biological functions of these proteins are still unclear, whether they play a role in the pathogenic process of A. baumannii needs further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An immunoprotective Acinetobacter baumannii surface antigen Sura1
  • An immunoprotective Acinetobacter baumannii surface antigen Sura1
  • An immunoprotective Acinetobacter baumannii surface antigen Sura1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, the preparation of bacterial protein sample

[0037] Protein sample preparation

[0038] Take 1 mL each of the standard Acinetobacter baumannii strain ATCC19606 and the isolated strain CCGGD201101 frozen in a -80°C refrigerator, inoculate them in 200 mL of liquid LB medium and culture them at a constant temperature of 37°C and 180r / min for 7 hours. Weigh and mark the weight of 50mL centrifuge tubes before centrifugation, centrifuge at 10000r / min at 4°C for 10min, discard the supernatant, and wash twice with sterilized water, collect the bacteria and weigh the total weight, and calculate the weight of the collected bacteria . Add 10mL0.1mol / L Tris-Cl to both ATCC19606 and CCGGD201101 to suspend the precipitate, then add 100uL protease inhibitor and 100uL ribozyme mixture and mix well. Then ultrasonic crushing was carried out at a power of 200w, 5s / time, with an interval of 15s between each time, and ultrasonication for 10min each. The whole process was op...

Embodiment 2

[0054] Embodiment 2, the expression of SurA1 protein

[0055] 1. Extraction of A.baumannii total DNA

[0056] Centrifuge 2ml of the overnight culture of A.baumannii CCGGD201101 at 12,000rpm for 1min, discard the supernatant, and extract it using the Total Bacterial Genomic DNA Extraction Kit (Cat. No.: Soleborn D1600-100).

[0057] 2. Preparation of SurA1 gene

[0058] According to the nucleotide sequence of the SurA1 gene, the primers were designed as follows:

[0059] Upstream primer: atggtaaaagattggattcccatc

[0060] Downstream primer: ctagtcttcaatgacgtgtaaacca

[0061] Using the total genomic DNA of A. baumannii as a template, the designed primers were used for PCR amplification.

[0062] Amplification system:

[0063] Ex taq DNA polymerase 1 μL

[0064] 10x Ex Taq DNA Polymerase Buffer 5 μL

[0065] dNTP Mix 0.4μL

[0066] Genome template 1 μL

[0067] Upstream primer 1 μL

[0068] Downstream primer 1 μL

[0069] wxya 2 O 40.6μL

[0070] Total 50μL

[0071] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to immunity-protective Acinetobacter baumannii surface antigen SurAl and belongs to bacterial surface antigen recombinant proteins. The amino acid sequence of the immunity-protective Acinetobacter baumannii surface antigen SurAl is shown in SEQ ID No. 1; the nucleotide of the immunity-protective Acinetobacter baumannii surface antigen SurAl is encoded, under a sequence shown in SEQ ID No.2. The immunity-protective Acinetobacter baumannii surface antigen SurAl has low toxicity to human pulmonary epithelial cells A549, provides effective immunity protection for mice from being infected by Acinetobacter baumannii, and can be used as a candidate antigen for the development of subunit vaccines of Acinetobacter baumannii.

Description

technical field [0001] The invention relates to a bacterial surface antigen recombinant protein, the protein relates to the technical field of disease subunit vaccine preparation, and the protein is toxic to cells. It specifically relates to the identification of an immunoprotective antigen of Acinetobacter baumannii, the cloning of the protein gene and the application of its encoded recombinant protein in vaccines, and at the same time, the protein is toxic to human lung epithelial cells A549. Background technique [0002] Acinetobacter baumannii is an important opportunistic pathogen. In recent years, due to the overuse of antibiotics and their increasing drug resistance, researchers have paid serious attention. A. baumannii mainly causes respiratory tract infection, and can also cause sepsis, urinary tract infection, secondary meningitis, etc. A. baumannii is distributed in a variety of harsh environments and can survive for a long time, which poses a great threat to im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/22C12N15/31C12N15/70C12N1/21A61K39/02A61P31/04C12R1/01
CPCA61K39/02C07K14/212C12N15/70
Inventor 任洪林刘东卢士英胡盼李岩松冯小丽崔树森柳溪林柳增善
Owner JILIN UNIV