Hereditary optic neuropathy gene detection method, gene chip and kit
An optic neuropathy and gene chip technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of strict PCR amplification conditions and increase of false negatives.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1 A kit of the present invention
[0046] see figure 1, The chip kit provided by the present invention is composed of three components: a solid-phase chip for optic neuropathy gene SNP detection, probe components required for multiplex PCR, hybridization solution and eluent components of the kit. Among them, the solid-phase chip for optic neuropathy gene SNP detection includes a solid-phase carrier and a detection probe (21 bases) immobilized on the solid-phase carrier, wherein the solid-phase carrier can be made of silicon chips or glass slides (but not limited to The above materials), the surface is modified with amino or aldehyde groups; the probe components required for multiplex PCR include multiplex PCR primers: sample forward primer 1: ACAGGGTTTGTTAAGATGGC AGA (ID: SEQ118), reverse primer 1: GACTAGTTCGGACTCCCC TTC G( ID: SEQ119); forward primer 2: CCCCTTCGCCCTATTCTTCAT (ID: SEQ120), reverse primer 2: GGTGCCTTGGGTAACCTCTG G (ID: SEQ121); forward prime...
Embodiment 2
[0047] Example 2 Detection of Hereditary Optic Neuropathy Families Carrying Mitochondrial DNA Mutations
[0048] 1. Test samples
[0049] Select 5 typical hereditary optic neuropathy families EP1, EP2, EP3, EP4, EP5. See the figure below for his pedigree. This family presents a typical maternal inheritance, and the only clinical symptom of the patients is vision loss, but the degree of visual impairment of each affected member in the family varies.
[0050] 2. Chip Fabrication and Analysis
[0051] (1) Amplification and purification of labeled samples: Multiplex PCR amplification was performed on DNA extracted from clinical samples, and Cy3-dCTP or Cy5-dCTP was introduced into the amplification to obtain target gene fragments as described in Table 1; prepared in the following system Reaction system: 5XPhusion Buffer: 5uL, Template (50ng / uL) 1uL, Primer Mix (19uM) 1uL, 10mMdNTP Mix (Cy3-dCTP:dCTP=1:10) 0.5uL, Phusion High-Fidelity DNAPolymerase (2U / uL) 0.25 uL, deionized wa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com