Platanus pollen allergen Pla a 3 and monoclonal antibody thereof

A monoclonal antibody, sycamore technology, applied in chemical instruments and methods, anti-plant immunoglobulins, biochemical equipment and methods, etc., can solve problems such as little known allergens

Inactive Publication Date: 2016-04-13
JIANGSU PROVINCE HOSPITAL
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But little is known

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Platanus pollen allergen Pla a 3 and monoclonal antibody thereof
  • Platanus pollen allergen Pla a 3 and monoclonal antibody thereof
  • Platanus pollen allergen Pla a 3 and monoclonal antibody thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention will be further described below in combination with specific embodiments and accompanying drawings.

[0025] Identification of sycamore pollen allergen Plaa3:

[0026] pSUMO-Mut-Plaa3 plasmid construction:

[0027] The complete sequence of the target gene Plaa3 (SEQIDN0.2) was artificially synthesized and connected between the StuI and XhoI sites of the vector pSUMO-Mut, and the obtained recombinant plasmid pSUMO-Mut-Plaa3 was transferred into the ArcticExpress expression strain. The positive clones were picked for sequencing, and the sequencing results are shown below, the single-lined region is the Plaa3 gene region.

[0028] TATTTGAGGCTCACCGCGAACAGATTGGAGGT GCCATAACATGTGGTACGGTGGTGACCAGGCTGACCCCATGCCTCACCTTCTTGCGCTCTGGTGGGGCTGTAGCGCCCGCTTGCTGCAACGGCGTGAAGGCACTCAACAACGACGCTAAAACCACCCCAGACCGTCAGGCCGCTTGTGGATGTTTGAAGACTGCCTCCACCTCCATCTCCGGGATCCAGCTCGGTAACGCTGCCTCGCTTGCCGGCAAATGTGGTGTTAATCTCCCTTACAAGATCAGCCCCACCATTGACTGCTCCAAGGTGAAGTGA CTCGAGCACC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Theoretical molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a platanus pollen allergen Pla a 3, a monoclonal antibody thereof and a preparation method of the monoclonal antibody. The platanus pollen allergen Pla a 3 is separated from phoenix tree pollen in a purification mode, and the apparent molecular weight of fusion protein SUMO-Pla a 3 of the platanus pollen allergen Pla a 3 is measured as 28 kDa through SDS-PAGE. The protein Pla a 3 is separated from the phoenix tree pollen in the purification mode, the molecular weight of the fusion protein SUMO-Pla a 3 of the platanus pollen allergen Pla a 3 is measured as 28 kDa through SDS-PAGE. The monoclonal antibody prepared through the platanus pollen allergen Pla a 3 is characterized in that the monoclonal antibody can be specifically combined with the platanus pollen allergen Pla a 3 and plays an important role in diagnosis and treatment of allergic skin diseases, asthmas and other I-type allergic diseases caused by phoenix tree pollen.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a sycamore pollen allergen Plaa3 and a monoclonal antibody thereof. Background technique [0002] The sycamore tree is a large number of green plants on the market. It blooms in spring and the flowering period is from April to May. Its pollen can cause allergic skin diseases and allergic asthma and other diseases. [0003] Hay fever is mostly related to the rise and fall of allergens in the surrounding environment. It is a seasonal disease, and it is most likely to occur in spring and summer. In northern my country, the two peak periods of hay fever are mainly April to May and August to September. moon [1] . The northern part of our country is windy and dry, while the south is humid and rainy. Therefore, the hay fever is mainly in the north, followed by the south. It can be seen that pollinosis is related to climatic conditions. Therefore, it is very important for hay f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C07K16/16C12N5/20
CPCC07K14/415C07K16/16
Inventor 杨海伟魏继福倪玮玮
Owner JIANGSU PROVINCE HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap