Unlock instant, AI-driven research and patent intelligence for your innovation.

Three-line hybrid wheat seed purity molecular markers and their primer pairs and applications

A technique for hybrid purity and molecular markers, which is applied in the field of three-line hybrid wheat seed purity molecular markers and their primer pairs and applications, can solve the problems of insufficient space for display, technical sensitivity discount, etc., and achieve the effect of ensuring practicability

Active Publication Date: 2017-02-01
XINJIANG ACADEMY OF AGRI & RECLAMATION SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because all components of gliadin are separated by electrophoresis in one gel, there is not enough space to display all components, which greatly reduces the sensitivity of this technique.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Three-line hybrid wheat seed purity molecular markers and their primer pairs and applications
  • Three-line hybrid wheat seed purity molecular markers and their primer pairs and applications
  • Three-line hybrid wheat seed purity molecular markers and their primer pairs and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] Below in conjunction with specific embodiment the present invention is described in further detail, but not as limiting the present invention. In the following description, different "one embodiment" or "embodiment" do not necessarily refer to the same embodiment. Furthermore, the particular features, structures, or characteristics of one or more embodiments may be combined in any suitable manner.

[0035] The embodiment of the present invention provides a three-line hybrid wheat seed purity molecular marker and its primer pair. The molecular marker is an SSR molecular marker. The molecular marker provided by the implementation of the present invention is Wmc474 located on chromosome 2A or Barc8 located on chromosome 1B .

[0036] The primer pairs of the above-mentioned molecular markers are specifically as follows, wherein

[0037] The sequence of the primer pair of Wmc474 located on chromosome 2A is:

[0038] Xwmc474L:ATGCTATTAAACTAGCATGTGTCG,

[0039] Xwmc474R: A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a triple crossing wheat seed purity molecular marker and a primer pair and application thereof. The molecular marker is an SSR molecular marker and is Wmc474 located on 2A chromosome or Barc8 located on 1B chromosome. By the triple crossing wheat seed purity molecular marker, the AL type triple crossing wheat seed purity can be identified accurately.

Description

technical field [0001] The invention relates to the technical field of breeding, in particular to a three-line hybrid wheat seed purity molecular marker, primer pair and application thereof. Background technique [0002] Utilizing wheat heterosis is an effective way to increase wheat yield per unit area. At present, the main ways of using heterosis in wheat are: "three-line method", "two-line method" and "chemical male killing method". [0003] The three-line method refers to the three-line matching of the sterile line, the maintainer line and the restorer line. The sterile line is the female parent, and the maintainer line is the male parent. The offspring of the sterile line is still male sterile. The sterile line is reproduced in cycles or used to prepare hybrids; the sterile line is used as the female parent, the restorer line is used as the male parent, and they are planted alternately, and the pollen of the sterile line is given to the sterile line through the restore...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 田笑明聂迎彬刘小芳
Owner XINJIANG ACADEMY OF AGRI & RECLAMATION SCI