Triple crossing wheat seed purity molecular marker and primer pair and application thereof
A hybrid seed purity and molecular marker technology, which is applied to the three-line hybrid wheat seed purity molecular marker and its primer pairs and application fields, can solve the problems of insufficient space for display and technical sensitivity discount, and achieve the effect of ensuring practicability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] The present invention will be described in further detail below in conjunction with specific examples, but not as a limitation of the present invention. In the following description, different "one embodiment" or "embodiment" do not necessarily refer to the same embodiment. Furthermore, the particular features, structures, or characteristics of one or more embodiments may be combined in any suitable manner.
[0035] The embodiment of the present invention provides a three-line hybrid wheat seed purity molecular marker and its primer pair. The molecular marker is an SSR molecular marker. The molecular marker provided by the implementation of the present invention is Wmc474 located on chromosome 2A or Barc8 located on chromosome 1B .
[0036] The primer pairs of the above-mentioned molecular markers are specifically as follows, wherein
[0037] The sequence of the primer pair of Wmc474 located on chromosome 2A is:
[0038] Xwmc474L:ATGCTATTAAACTAGCATGTGTCG,
[0039] X...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 