A combination of specific primers for identifying different species of Melilotus genus and its application
A primer combination and specific primer technology, applied in the field of bioengineering, can solve the problems of difficult classification, difficult to clearly distinguish sweet-scented osmanthus species, mixed sweet-scented osmanthus species, etc. The effect of identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1: A kind of specific primer combination kit for identifying different species of Melilotus genus includes:
[0037] Five combinations of basic primers ITS, psbA-trnH, rbcL, matK, trnL PCR detection system, the total volume of the PCR detection system is 25μl, including 2×Reaction Mix 12.25μl, Golden DNA Polymerase 0.25μl, forward and reverse primers Average 2.5μl,
[0038] ITS·F(5′·3′)GGAAGKARAAGTCGTAACAAGG
[0039] ITS·R(5′·3′)RGTTTCTTTTTCCTCCGCTTA
[0040] rbcL·F(5′·3′)AGACCTWTTTGAAGAAGGTTCWGT
[0041] rbcL·R(5′·3′)TCGGTYAGAGCRGGCATRTGCCA
[0042] matK·F(5′·3′)CCCRTYCATCTGGAAATCTTGGTTC
[0043] matK·R(5′·3′)GCTRTRATAATGAGAAAGATTCTGC
[0044] trnL·F(5′·3′)CGAAATCGGTAGACGCTACG
[0045] trnL·R(5′·3′)ATTTGAACTGGTGACACGAG
[0046] psbA·F(5′·3′)GTTATGCATGAACGTAATGCTC
[0047] trnH·R(5′·3′)CGCGCATGGTGGATTCACAAATCITS·F(5′·3′),ddH 2 O 5 μl;
Embodiment 2
[0048] Embodiment 2: A method for identifying different species of Melilotus genus in combination with five specific primers, the specific steps are as follows:
[0049]1) DNA extraction of seedlings: use SDS method to extract, (1) clean the whole plant of seedlings after 7 days of cultivation, put them in a mortar and grind them thoroughly (2) add 600μl DNA buffer and mix evenly and pour into a 1.5ml centrifuge tube, 65 ℃ water bath for 10 minutes, shake 1-2 times during the period (3) put it to room temperature, add 195 μl 15mol potassium acetate (PH=6.0), and place on ice for 5 minutes (4) add 600 μl chloroform isoamyl alcohol (24:1), mix well (5) Centrifuge at room temperature for 10 minutes at 12000 rpm, pipette 360 μl of supernatant into a new 1.5ml centrifuge tube (6) add 54 μl of 3mol sodium acetate and 360 μl of isopropanol, mix well, and place at room temperature for 10 minutes (7) Centrifuge at room temperature for 10 minutes at 12000 rpm, Discard the supernatant ...
Embodiment 3
[0058] Example 3: A method for verifying the accuracy of five specific primer combinations for identifying different species of Melilotus genus:
[0059] In order to verify the accuracy of the specific primer combinations, 20 individual plants of 5 different materials were randomly selected and sequenced according to the steps in Example 2 (single plant DNA sequencing), the resulting sequences were spliced according to five combinations, and then combined with the corresponding combinations A phylogenetic tree was constructed by clustering, and as a result, more than 90% of each material (Melilotus clover is a cross-pollinated plant) can be gathered into the same species, such as Image 6 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


