Application of dual specificity phosphatase 14 (dusp14) in liver ischemia-reperfusion injury

A technology for reperfusion injury and liver ischemia, applied in the field of gene function and application, can solve problems such as unclear effects, and achieve the effect of inhibiting liver tissue ischemia-reperfusion injury

Active Publication Date: 2019-08-20
WUHAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that Dusp14 can regulate the phosphorylation levels of ERK, JNK and P38 in primary T cells [5] ; Dusp14 active site mutation (C111S) can activate ERK and promote β-cell proliferation [6] ;Dusp14 plays an important protective role in aortic coarctation-induced cardiac hypertrophy through TAK1-P38 / JNK signaling pathway [7] , while its role in liver ischemia-reperfusion injury is unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of dual specificity phosphatase 14 (dusp14) in liver ischemia-reperfusion injury
  • Application of dual specificity phosphatase 14 (dusp14) in liver ischemia-reperfusion injury
  • Application of dual specificity phosphatase 14 (dusp14) in liver ischemia-reperfusion injury

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of hepatocyte-specific Dusp14 knockout mice and Dusp14 transgenic mice

[0035] (1) Construction of hepatocyte-specific Dusp14 gene knockout mice (see figure 1 A)

[0036] According to the information of Dusp14 gene, CRISPR Design was used to design a CRISPR targeting site in intron 2 and 3 respectively. The target sequences are:

[0037] Dusp14-sRNA1: ggATAAGTCATTTTCTATTGACCAT TGG;

[0038] Dusp14-sRNA2: GGTTCTCCCGAGAGGGTTTCTACGC TGG.

[0039] In addition, a donor vector (Donor Vector) for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle and two loxp sequences in the same direction.

[0040] 1) Construction of targeting vector: respectively fuse two primers corresponding to sgRNA1 and sgRNA2 into double-stranded DNA, and then use T4 DNA ligase to ligate into pUC57-sgRNA (Addgene 51132) vector treated with restriction endonuclease BsaI . There is a T7 promoter upstream of the vector, which can be...

Embodiment 2

[0060] Example 2 Obtainment of mouse liver ischemia-reperfusion injury (ischemia / reperfusion injury, I / R) model

[0061] (1) Grouping of experimental animals: male C57BL / 6 strain wild-type mice, liver cell-specific Dusp14 gene knockout mice, Dusp14 transgenic mice, and non-transgenic mice. Liver ischemia-reperfusion was established by liver ischemia-reperfusion Injury model (I / R). They were randomly divided into 8 groups: C57BL / 6J strain wild-type mice sham operation group (WT Sham) and I / R operation group (WT I / R), liver cell-specific Dusp14 gene knockout mouse sham operation group (KO Sham ) and I / R operation group (KO I / R), non-transgenic mouse sham operation group (NTG Sham) and I / R operation group (NTG I / R), liver cell-specific Dusp14 transgenic mouse sham operation group ( TG Sham) and I / R surgery group (TG I / R).

[0062] (2) I / R model surgery of hepatic ischemia-reperfusion injury (using non-invasive vascular clips to clamp the portal vein and hepatic artery in the mi...

Embodiment 3

[0068] Example 3 Determination of liver necrosis area and liver function indexes (AST, ALT)

[0069] The evaluation indicators of the severity of liver ischemia-reperfusion injury mainly include the area of ​​liver necrosis and liver function indicators (AST, ALT), all of which are positively correlated with the severity of liver ischemia-reperfusion injury.

[0070] (1) Take materials

[0071] Mice in the sham operation group (Sham) and the ischemia-reperfusion group were collected at 1h, 3h, 6h, and 24h after operation, and sacrificed by cervical dislocation. Immediately, 1 mL of blood was collected from the inferior vena cava, and the serum was separated. At the same time, the left lobe of the liver in the ischemic area with a size of about 1.5cm×1cm×0.2cm was fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, paraffin-sectioned, and then stained with HE.

[0072] Separation of serum: the EP tube where the blood was collected was left at room temperature for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses application of dual-specificity phosphatase 14(Dusp14) to hepatic ischemia reperfusion injury, and belongs to the field of gene functions and application. A mouse with a hepatocyte-specific Dusp14 gene deleted and a Dusp14 transgenic mouse serve as experiment objects, the functions of the Dusp14 gene are studied through a hepatic ischemia reperfusion injury model, and it is found that the Dusp14 has an effect of improving the hepatic ischemia reperfusion injury. Thus, the Dusp14 has the following application: the application of the Dusp14 as a medicine target to screening medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injury and the application of the Dusp14 to preparing the medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injury, wherein screening the medicines for preventing, relieving and / or treating the hepatic ischemia reperfusion injury refers to screening the medicines capable of promoting Dusp14 expression.

Description

technical field [0001] The invention belongs to the field of gene function and application, and relates to the application of dual-specificity phosphatase 14 (Dusp14) in liver ischemia-reperfusion injury, in particular to the application of Dusp14 in the screening or preparation of preventing, alleviating and / or treating liver ischemia-reperfusion Application in injury medicine. Background technique [0002] Hepatic ischemia-reperfusion (I / R) injury is the liver ischemia caused by hepatic blood flow occlusion or extracorporeal perfusion of the liver donor during liver surgery or liver transplantation. After the liver blood flow is restored, Physiological and pathological processes leading to aggravated liver damage and even dysfunction [1] . Liver I / R injury can be divided into warm ischemia and cold ischemia according to different ischemia conditions. Warm ischemia often occurs in routine liver surgery and liver trauma, and may also occur in certain types of toxic liver i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P1/16A61P9/10G01N33/573
Inventor 李红良张晓晶王晓占毛文哲
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap