A vector suitable for the genetic transformation and cloning of fungi such as Chinese Mortierella hirsutella sinensis and its construction method

A technology of vector and insect-growing fungi, applied in the field of genetic engineering, can solve the problems such as the unseen eGFP gene, and achieve the effect of good application prospect.

Active Publication Date: 2020-10-30
成都图径生物科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there is no report on the successful introduction and stable expression of the egfp gene into Hirsutella sinensis in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A vector suitable for the genetic transformation and cloning of fungi such as Chinese Mortierella hirsutella sinensis and its construction method
  • A vector suitable for the genetic transformation and cloning of fungi such as Chinese Mortierella hirsutella sinensis and its construction method
  • A vector suitable for the genetic transformation and cloning of fungi such as Chinese Mortierella hirsutella sinensis and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1 Construction of the recombinant plasmid of the present invention

[0040] 1. Full-length cloning of promoters pAT and pTrpc

[0041] Follow these steps:

[0042] (1) According to the entomogenous fungus genome information, first find the pAT and pTrpc gene sequence information, and then find its promoter sequence information at the front end of the AT protein and trpc gene;

[0043] (2) According to the promoter sequence information found in the entomogenous fungal genome, design corresponding amplification promoter-specific primers:

[0044] pAT-F: GTTGAGTTTGTTGATTGCAAT

[0045] pAT-R: AACCGTATACGATTCTAGCT

[0046] pTrpc-F: ACGTCAACGATACGTGCTAAC

[0047] pTrpc-R: CAAGCTTTTCTAGTGCACCTACG

[0048] The total DNA of entomogenous fungi was extracted by CTAB method, using Premix Taq TM The promoter pAT and pTrpc fragments were amplified by PCR. The PCR reaction volume is 20 μL, including 10 μL Mix, 1 μL forward primer, 1 μL reverse primer, 1 μL DNA template...

Embodiment 2

[0084] Embodiment 2 Construction of engineering bacteria of the present invention

[0085] (1) Preparation of Agrobacterium tumefaciens competent cells and vector transformation

[0086] A single colony of Agrobacterium tumefaciens AGL-1 was picked, inoculated in 5ml LB (containing 20 μg / mL Rif) liquid medium, and cultured at 28°C with shaking at 200r / min for 15h.

[0087] Add 2 mL of overnight cultured bacterial solution to 50 mL of LB medium containing the same antibiotic, shake at 28°C for 3.5 hours at 200 r / min, until OD 600 ≈0.6~0.7; draw the bacterial liquid into a 50mL pre-cooled centrifuge tube, put it in an ice bath for 10min; centrifuge at 5000r / min at 4°C for 10min, discard the supernatant; slowly add 10mL of pre-cooled 100mM CaCl 2 solution, gently suspend the Agrobacterium cells, and place in an ice bath for 30 min; centrifuge at 5000 r / min at 4°C for 10 min, discard the supernatant, and add 2 mL of pre-cooled 100 mM CaCl containing 15% glycerol on ice 2 solutio...

experiment example 1

[0092] Experimental Example 1 Transformation of Hirsutella sinensis with plasmid pRF-AETH

[0093] 1. Method for Agrobacterium tumefaciens-mediated genetic transformation of Hirsutella sinensis in China

[0094] (1) Pre-induction of Agrobacterium tumefaciens

[0095] Agrobacterium tumefaciens AGL-1 / pRF-AETH was streak inoculated, cultured at 28°C for 2 days, picked a single clone with a sterile pipette tip and inoculated into 10 mL liquid LB medium, and cultured at 28°C, 200 r / min for 15 hours.

[0096] Centrifuge the Agrobacterium cultured overnight, discard the supernatant, resuspend twice in an equal volume of IM medium, and then adjust the concentration of Agrobacterium to OD 600 ≈0.15~0.20, add AS (acetosyringone) to a final concentration of 200 μM. 28°C, 200r / min continue to culture for 6h to OD 600 ≈0.6~0.7 can be used for co-culture transformation of Agrobacterium tumefaciens and Hirsutella sinensis. IM medium formula: 10mM Glucose, 0.6mM CaCl 2 , 9μM FeSO 4 , 50...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant plasmid, which is characterized in that promoters, pGpdA and Trpc, in a plasmid pRFHUE-eGFP are respectively replaced by promoters, pAT and pTrpc, in a plasmid of entomogenous fungus. The invention also discloses a preparation method and an application of the recombinant plasmid, and discloses engineering bacteria that include the recombinant plasmid, as well as a preparation method and an application thereof. In the invention, the recombinant plasmid pRF-AETH as well as the engineering bacteria comprising same can convert Hirsutella sinensis, wherein blastospore and mycelia with strong green fluorescence of a conversion strain of the Hirsutella sinensis can be observed under a fluorescence microscope; this phenomenon indicates that in the recombinant plasmid pRF-AETH, an egfp gene can be effectively expressed in the Hirsutella sinensis, so that the recombinant plasmid can be applied to researches on growth, reproduction, development and differentiation processes of the Hirsutella sinensis. The recombinant plasmid supplies support to artificial cultivation of Cordyceps sinensis and has great application prospect.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a carrier suitable for genetic transformation and cloning of fungi such as Hirsutella inensis and a construction method thereof. Background technique [0002] Cordyceps sinensis is a unique Chinese herbal medicine. Since it was recorded in the Tibetan medical book "Thousands of Relics" in the 15th century, and many subsequent documents such as "Compendium of Materia Medica" have recorded that it has unique effects, its market demand is large, and due to the specific growth environment and Due to the crazy collection in recent years, its output has been greatly reduced, and it is in danger of extinction, and has become a rare resource. Therefore, it is very important to artificially cultivate Cordyceps sinensis. However, because the formation process and mechanism of Cordyceps sinensis are very complicated, although many scientific research units, colleges and universities, ent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/80C12N1/15C12N1/21C12R1/01C12R1/645
CPCC07K14/43595C12N15/80C12N2800/10
Inventor 赵成郑丽斌蓝贤清曹姣方呈祥
Owner 成都图径生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap