A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its application

A technology for hydrolyzing enzymes and epoxides, which is applied in the field of enzyme engineering, can solve the problem that stereoselectivity cannot satisfy the production of high-enantiopure epoxides and vicinal diols, and achieve the effect of improving enantioselectivity

Active Publication Date: 2020-05-08
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The present invention adopts the method of whole plasmid PCR to carry out unidirectional site-directed mutation on 102-position tryptophan, obtains the mutant enzyme W102L with simultaneously improved stereoselectivity and catalytic activity, and solves the problem that the stereoselectivity cannot satisfy the production of high enantiopure epoxides The demand for vicinal diols lays the foundation for broadening the industrial application of PvEH1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its application
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its application
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Mutant plasmid construction

[0030] The E.coli BL21(DE3) / pET-28a-pveh1 (Ye Huihua, Hu Die, Li Chuang, et al. New type of common bean Heterologous expression and enantio-normalized catalytic properties of epoxide hydrolase[J]. China Biotechnology, 2016, 36(10): 21-27. 169: 41-54.) Plasmids were extracted as unidirectional site-directed mutagenesis template,

[0031]The primers used were W102L-F (5'-3'GTTGCCCATGATCTCGGAGCCCTAGTA); W102L-R (TACTAGGGCTCCGAGATCATGGGCAAC).

[0032] use HS PCR enzyme (purchased from TaKaRa Company) adopts the method of whole plasmid PCR. Using the PvEH1 plasmid as a template, PCR conditions: denaturation at 98°C for 10 s; annealing at 55°C for 5 s; extension at 72°C for 3.5 min, 30 cycles, and extension at 72°C for 10 min. The PCR product was transformed into E.coli BL21 (DE3) competent cells by digesting the template plasmid with Dpn I enzyme, and the transformation was performed according to the instruction manual of the SK9...

Embodiment 2

[0033] Embodiment 2: the acquisition of mutant enzyme

[0034] The obtained mutant enzyme expression vector was inoculated (the inoculum size was 1%) in 2 mL of LB medium containing 1% kanamycin, at 37 ° C, 220 r min -1 Cultivate overnight; take 2mL culture medium and transfer to 100mL LB medium containing 1% kanamycin, cultivate to OD 600 When it is 0.6~0.8, add 100μL of IPTG (500mmol·L -1 ) to a final concentration of 0.5mmol L -1 After induction at 20°C for 10 h, the recombinant bacterial cells were collected by centrifugation. It was determined that the enzyme activity of the epoxide hydrolase of the bacteria to rac-pCSO was 27U / g of the bacteria.

Embodiment 3

[0035] Example 3: Analysis of initial substrate concentration for whole cell catalysis

[0036] Add the wet bacterial suspension to the 2mL EP tube with a concentration of 200mg·mL -1 PvEH1 W102L Whole cells, substrate initial concentration from 0 to 300mmol·L -1 rac-pCSO, the buffer is sodium phosphate buffer (pH=7.0, 100mmol·L -1 ), the reaction system is 1mL, 25℃, 220r·min -1 After reacting in a constant temperature shaker for 12 hours, take 50 μL of the sample and extract it with 1 mL of ethyl acetate, dry the organic phase over anhydrous magnesium sulfate, and measure ee by HPLC s .

[0037] Such as figure 1 As shown in (a), using PvEH1 W102L No obvious by-products were observed during whole-cell catalyzed hydrolysis of rac-pCSO, in which (S)-pCSO was catalyzed by PvEH1 W102L Preferentially catalyzes hydrolysis to (R)-pCPED.

[0038] Use a final concentration of 200mg·mL -1 PvEH1 W102L Separately split the initial concentration from 50 to 300mmol·L -1 Different...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phaseolus vulgaris epoxide hydrolase mutant with improved stereoselectivity and application thereof, and belongs to the technical field of enzyme engineering. According to the invention, unidirectional site-directed mutagenesis is carried out by epoxide hydrolase from phaseolus vulgaris so as to obtain a mutant enzyme W102L with improved enantioselectivity and enantio-polarity. Compared to a wild type, an E value of the W102L for racemized p-chlorobenzenethiol styrene oxide rac-pCSO is increased to 25.5 from 2.6, and enantioselectivity of the W102L for the rac-pCSO isimproved by 9.8 times. 150mmol.L-1 of rac-pCSO is resolved by using PvEH1W102L whole-cell dynamics, and after a reaction is performed by 4h, yield of 45.62% (ees=96.30%) of (R)-p-chlorobenzenethiol styrene oxide and yield of 50.91% (eep=90.26%) of (R)-p-chlorobenzenethiol phenyl ethylene glycol can be obtained.

Description

technical field [0001] The invention relates to a mutant of kidney bean epoxyhydrolase with improved stereoselectivity and application thereof, belonging to the technical field of enzyme engineering. Background technique [0002] Enantiopure p-chlorostyrene oxide (pCSO) and its hydrolysis product p-chlorophenylethylene glycol (pCPED) are important intermediates for various chiral drugs and functional materials, such as R-type p-chlorostyrene oxide ( (R)-pCSO) can be used for the synthesis of CB1 antagonists; R-type p-chlorophenylethylene glycol ((R)-pCPED) is an important chiral building block of NMDA receptor inhibitor - ilirodine. Currently, a series of biochemical methods for the synthesis of enantiopure pCSO and pCPED have been reported. Among them, Suresh et al. used a class of chiral macrocyclic Schiff bases to catalyze the oxygenation of p-chlorostyrene to synthesize (R)-pCSO, and its ee P Up to 47%; Karboune et al. used epoxide hydrolase (AnEH) from recombinant Asp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P41/00C12P17/02C12P7/22
CPCC12P7/22C12P17/02C12P41/001
Inventor邬敏辰宗迅成阚婷婷胡蝶李剑芳
OwnerJIANGNAN UNIV