A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its construction method

An epoxide hydrolase and mutant technology, applied in the field of enzyme engineering, can solve the problem that the stereoselectivity cannot meet the production of high enantiopurity epoxides and vicinal diols, etc., and achieve the effect of improving the enantioselectivity

Active Publication Date: 2020-12-01
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The present invention adopts the method of whole plasmid PCR to carry out unidirectional site-directed mutation on 102-position tryptophan, obtains the mutant enzyme W102L with simultaneously improved stereoselectivity and catalytic activity, and solves the problem that the stereoselectivity cannot satisfy the production of high enantiopure epoxides The demand for vicinal diols lays the foundation for broadening the industrial application of PvEH1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its construction method
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its construction method
  • A kind of bean epoxyhydrolase mutant with improved stereoselectivity and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Mutant plasmid construction

[0030] The E.coliBL21(DE3) / pET-28a-pveh1 (Ye Huihua, Hu Die, Li Chuang, etc.) preserved from the laboratory using the PurePlasmid Mini Kit (purchased from Kangwei Reagent Co., Ltd.). Heterologous expression and enantio-normalized catalytic properties of oxide hydrolase[J]. China Biotechnology, 2016, 36(10): 21-27. 169: 41-54. template,

[0031]The primers used were W102L-F (5'-3'GTTGCCCATGATCTCGGAGCCCTAGTA); W102L-R (TACTAGGGCTCCGAGATCATGGGCAAC).

[0032] use HS PCR enzyme (purchased from TaKaRa Company) adopts the method of whole plasmid PCR. Using the PvEH1 plasmid as a template, PCR conditions: denaturation at 98°C for 10 s; annealing at 55°C for 5 s; extension at 72°C for 3.5 min, 30 cycles, and extension at 72°C for 10 min. The PCR product was transformed into E.coliBL21(DE3) competent cells by using Dpn I enzyme to digest the template plasmid, and the transformation was performed according to the instruction manual of ...

Embodiment 2

[0033] Embodiment 2: the acquisition of mutant enzyme

[0034] The obtained mutant enzyme expression vector was inoculated (the inoculum size was 1%) in 2 mL of LB medium containing 1% kanamycin, at 37 ° C, 220 r min -1 Cultivate overnight; take 2mL culture medium and transfer to 100mL LB medium containing 1% kanamycin, cultivate to OD 600 When it is 0.6~0.8, add 100μL of IPTG (500mmol·L -1 ) to a final concentration of 0.5mmol L -1 After induction at 20°C for 10 h, the recombinant bacterial cells were collected by centrifugation. It was determined that the enzyme activity of the epoxide hydrolase of the bacteria to rac-pCSO was 27U of the bacteria cells.

Embodiment 3

[0035] Example 3: Enantioselectivity comparison of enzymes before and after mutation to rac-pCSO

[0036] The invention compares the stereoselectivity of the enzyme before and after the mutation, and the stereoselectivity includes two properties of enantioselectivity and enantionormalization. Wherein the wild enzyme refers to PvEH1 derived from Phaseolus vulgaris, GenBank accession no. XM007146940.

[0037] Use 1ml of sodium phosphate buffer solution (pH=7.0, 100mmol·L) for every 20mg of wet bacteria -1 ) suspension, take 1mL and add it to a 2mLEP tube, add 50μL of 200mmol·L -1 rac-pCSO (solvent is methanol), the final substrate concentration is 10mmol L -1 . Placed at 25°C, 220r·min -1 Shaking table reaction, 50 μL samples were extracted three times with ethyl acetate (1 mL in total) at 30 min, 1 h, 2 h and 24 h respectively, dried with anhydrous magnesium sulfate and analyzed by high performance liquid chromatography. When the conversion rate c was about 50%, the E valu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kidney bean epoxy hydrolase mutant with improved stereoselectivity and an establishment method and belongs to the technical field of enzyme engineering. According to the establishment method, one-way site-specific mutagenesis is implemented through epoxy hydrolase derived from kidney beans, and a mutation enzyme W102L of which enantioselectivity and enantiounification areimproved is obtained. The final eep of W102L upon racemization m-chloro-styrene oxide (rac-mCSO) is improved to 81.7% from 3.1% at 25 DEG C. Compared with a wild type, the W102L has an E value for the racemization m-chloro-styrene oxide rac-pCSO increased to 25.5 from 2.6 and stereoselectivity improved by 9.8 times for rac-pCSO.

Description

technical field [0001] The invention relates to a mutant of kidney bean epoxyhydrolase with improved stereoselectivity and a construction method, belonging to the technical field of enzyme engineering. Background technique [0002] Enantiopure p-chlorostyrene oxide (pCSO) and its hydrolysis product p-chlorophenylethylene glycol (pCPED) are important intermediates for various chiral drugs and functional materials, such as R-type p-chlorostyrene oxide ( (R)-pCSO) can be used for the synthesis of CB1 antagonists; R-type p-chlorophenylethylene glycol ((R)-pCPED) is an important chiral building block of NMDA receptor inhibitor - ilirodine. Currently, a series of biochemical methods for the synthesis of enantiopure pCSO and pCPED have been reported. Among them, Suresh et al. used a class of chiral macrocyclic Schiff bases to catalyze the oxygenation of p-chlorostyrene to synthesize (R)-pCSO, and its ee p Up to 47%; Karboune et al. used epoxide hydrolase (AnEH) from recombinant A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/75C12N1/21C12N1/19
CPCC12N9/2497C12N15/75
Inventor邬敏辰宗迅成李闯石小玲袁风娇李剑芳
OwnerJIANGNAN UNIV