Unlock instant, AI-driven research and patent intelligence for your innovation.

A screening method for antisense oligonucleotides that inhibit exon cleavage suppressor function

A technology of antisense oligonucleotide and screening method, applied in the field of antisense oligonucleotide screening, can solve the problem of high cost of antisense oligonucleotide

Active Publication Date: 2020-10-13
WUHAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the cost of synthesizing antisense oligonucleotides is very high when screening in large quantities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A screening method for antisense oligonucleotides that inhibit exon cleavage suppressor function
  • A screening method for antisense oligonucleotides that inhibit exon cleavage suppressor function
  • A screening method for antisense oligonucleotides that inhibit exon cleavage suppressor function

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] [Example 1] Screening antisense oligonucleotides that can efficiently inhibit the exon splicing inhibitor function of SRSF3 exon 4

[0023] 1. According to our published research results 4 , we identified the exon splicing inhibitor of SRSF3 exon 4 and its upstream and downstream adjacent sequence CCTCACCTCACCA TTTC TAGCTTGTTGAAACCCA (exon splicing inhibitor sequence underlined).

[0024] 2. Based on this sequence, we designed a series of antisense oligonucleotides:

[0025] SR-2 GGTTTCAACAAGCTAGAAAT

[0026] SR-3GTTTCAACAAGCTAGAAATG

[0027] SR-4TTTCAACAAGCTAGAAATGG

[0028] SR-5 TTCAACAAGCTAGAAATGGT

[0029] SR-6 TCAACAAGCTAGAAATGGT

[0030] SR-7 CAACAAGCTAGAAATGGTG

[0031] SR-8AACAAGCTAGAAATGGTGA

[0032] SR-9 ACAAGCTAGAAATGGTGAG

[0033]SR-10 CAAGCTAGAAATGGTGAGG

[0034] SR-11 AAGCTAGAAATGGTGAGGT

[0035] At the same time, a non-specific antisense oligonucleotide (NS) was designed as a control, its sequence is: ACTCTATCTGCACGCTGACT.

[0036] These anti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for filtrating antisense oligodeoxynucleotide with a function of restraining exon shearing repressor. The method comprises the following steps that 1) exon shearing repressor and adjacent gene sequence of a target gene is obtained; 2) a series of antisense oligodeoxynucleotide modified through sulpho is designed and compounded according to the sequence; 3) the antisense oligodeoxynucleotide is transferred into a cell, and total protein is extracted after 24 hours, and the antisense oligodeoxynucleotide having best combining effect with the exon shearing repressor of the target gene is determined through a method of western hybrid; 4) according to the sequence of the antisense oligodeoxynucleotide obtained in step 3, 2'-O-Methyl and antisense oligodeoxynucleotide modified through sulpho are compounded and transferred into the cell, and can determine the function of efficiently restraining exon shearing repressor through a method of RT-PCR. The method forfiltrating antisense oligodeoxynucleotide with the function of restraining exon shearing repressor is suitable for economically filtrating the antisense oligodeoxynucleotide with the function of restraining exon shearing repressor, has good development and application prospects.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine. It specifically relates to a method for screening antisense oligonucleotides that inhibit the function of an exon splicing inhibitor. Background technique [0002] Eukaryotic genes contain exons and introns. When a gene is expressed, the precursor messenger RNA (mRNA) is first synthesized by RNA polymerase according to the DNA template of the gene. Pre-mRNA includes exons and introns. Then the spliceosome removes the introns and connects the exons to form a mature mRNA that can direct protein synthesis. However, the splicing of pre-mRNA is not static, for example: some exons may be excluded in the mature mRNA during splicing, called exon skipping (exon skipping), and some introns are retained in In the mature mRNA, it is called intron retention (intron retention). It can be seen that after the same gene is transcribed, various mRNAs can be produced through alternative splicing. It ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12Q1/6858
CPCC12N15/113C12N2310/11C12Q1/6858C12Q2525/117C12Q2531/113
Inventor 贾荣郭继华车晓轩
Owner WUHAN UNIV