Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of a long non-coding RNA TRALR

A technology of expression levels and reagents, applied in the application field of long-chain non-coding RNATRALR, which can solve problems such as unexplained specific mechanisms

Inactive Publication Date: 2021-09-07
XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The latest research shows that in addition to MGMT, the abnormality of various signaling pathways such as epidermal growth factor receptor (EGFR) in tumor cells is involved in the occurrence of TMZ resistance, but the specific mechanism has not yet been elucidated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a long non-coding RNA TRALR
  • Application of a long non-coding RNA TRALR
  • Application of a long non-coding RNA TRALR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 is to construct temozolomide-resistant T98G and U343 glioma cell lines

[0045] (1) IC50 was detected by MTS method: the cells were divided into 1×10 3 Seed in a 96-well plate at a density of / well, add a gradient concentration of temozolomide solution, and incubate at 37°C, 5% CO 2 Incubate for 72 h in an incubator. Add 20 μl MTS to each well. After incubating in the incubator for 2 h, the absorbance of each well was measured at 450 nm in a microplate reader. IC50 was calculated by SPSS software.

[0046] (2) Cell cycle detection by flow cytometry: the cells were divided into 1×10 6 The density was seeded in a 6-well plate, and temozolomide was added to incubate for 24 h. Digest the cells with trypsin, centrifuge at 1,000rpm for 4min after the digestion is terminated, and discard the supernatant. Wash the cells with ice-cold PBS, centrifuge at 1,000rpm for 4min, and discard the supernatant. Resuspend the cells in 100 μl PBS, slowly add 1ml 70-80% ethan...

Embodiment 2

[0047] Example 2 RT-PCR screening and verification of differentially expressed lncRNAs in glioma TMZ-resistant cells

[0048] (1) Extraction of total cellular RNA (TRIzol method)

[0049] The cells were seeded in 6-well plates and incubated in a 37°C, 5% CO2 incubator. After the cells were completely attached to the wall, 1000 μl TRIzol was added to each well. After standing still until completely dissolved, transfer to a 1.5ml EP tube. Add 0.2ml of chloroform, shake vigorously for 15 seconds, and place at room temperature for 3 minutes. Centrifuge at 4°C and 12000rpm for 15min, and transfer the supernatant to a new EP tube. Add 0.5ml of isopropanol and let stand at room temperature for 10min. After centrifugation at 4°C and 12,000 rpm for 10 minutes, a gelatinous precipitate appeared at the bottom of the EP tube. Discard the supernatant, wash the RNA pellet with 1ml 75℅ ethanol, and centrifuge at 4°C, 7500rpm for 5min, discard the supernatant again. After air-drying for...

Embodiment 3

[0072] Example 3 Smart Silencer Knockdown of lncRNA TRALR Causes G2 / M Phase Arrest and Inhibits Proliferation

[0073] 1) Inoculate cells: inoculate 1×10 5 ~5×10 5 Put the cells into the culture wells of a 24-well plate containing an appropriate amount of complete medium, so that the cell density at the time of transfection can reach 30-50%.

[0074] 2) Transfection step

[0075] For each transfection sample, prepare as follows:

[0076] a. Dilute lncRNASmart Silencer: use 30μl 1X riboFECT TM Dilute 2.5μl 20μM RiboTM lncRNASmart Silencer stock solution with CP Buffer and mix gently. The Smart Silencer sequence is as follows:

[0077] No. Target sequence (5'-3')

[0078] 1CCACCACTACAAAGCTTAA

[0079] 2CCTGTACATACCCAGATAA

[0080] 3CCTCTAACTAACATGACTT

[0081] 4GTAGGCACCTGACTTCGTGG

[0082] 5CTTGTGCAGGTGACAGGGAA

[0083] 6ACAGATTCGTGAGTGCCAGG

[0084] b. Mixture preparation: add 3μl riboFECT TM CP Reagent, gently pipette to mix, and incubate at room temperature for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of long-chain non-coding RNA TRALR. The present invention uses lncRNA sequencing to find that lncRNA TRALR is abnormally highly expressed in temozolomide-resistant glioma cell lines, and specifically interfering with the expression of lncRNA TRALR can significantly inhibit BMI1, up-regulate p21 levels, and promote cell cycle arrest and aging , increase the sensitivity of glioma temozolomide. Therefore, the reagents for detecting the expression of lncRNA TRALR can be used to prepare preparations for the diagnosis, prognosis, or sensitivity detection of glioma patients, providing a powerful tool for the diagnosis, prognosis, and chemotherapy sensitivity prediction of glioma patients. Based on molecular biology, it has far-reaching clinical significance and important promotion and application prospects.

Description

technical field [0001] The invention belongs to the technical field of tumor molecular biology, and specifically relates to the application of a long-chain non-coding RNA TRALR. Background technique [0002] Glioma is the most common malignant tumor of the central nervous system, accounting for about 80% of primary malignant brain tumors. According to the European Neuro-Oncology Association (EANO) statistics, the annual incidence of glioma in the world is about 6 / 100,000 . The treatment of glioma is a worldwide problem, especially for malignant glioblastoma. Even if the optimal treatment plan is adopted, the prognosis of patients is still very unsatisfactory, and the average survival period is only 13.3-15 months. Temozolomide (TMZ) is a new drug with better efficacy in the treatment of glioma that has emerged in the past two decades. It has been approved by the US FDA and recommended by the National Comprehensive Cancer Network guidelines and has become the preferred chemo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886
CPCC12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 龚志成颜元良徐志杰陈曦霍雷李学军曾双双钱龙熊小明
Owner XIANGYA HOSPITAL CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com