A constant temperature strand displacement amplification technique and kit

A strand displacement amplification and strand displacement technology, which is applied in the field of new constant temperature strand displacement amplification technology and kits, can solve the problems of nucleic acid isothermal amplification, achieve good specificity and solve technical defects

Active Publication Date: 2020-06-09
贠红岩
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the technical defects of the existing nucleic acid isothermal amplification, an object of the present invention is to provide a novel constant temperature strand displacement amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A constant temperature strand displacement amplification technique and kit
  • A constant temperature strand displacement amplification technique and kit
  • A constant temperature strand displacement amplification technique and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1 Amplification of Human Papillomavirus 18 Subtypes

[0053] Taking human papillomavirus subtype 18 as an example, it is amplified using the constant temperature strand displacement amplification technique described in the present invention.

[0054] HPV18 DNA fragment (plasmid sequence):

[0055] 5’-AATATGGGAACACAGGTACGTGGGAAGTACATTTTGGGAATAATGTAATTGATTGTAATGACTCTATGTGCAGTACCAGTGACGACACGGTATCCGCTACTCAGCTTGTTAAACAGCTACAGCACACCCCCTCACCGTATTCCAGCACCGTGTCCGTGGGCACCGCAAAGACCTACGGCCAGACGTCGGCTGCTACACGACCTGGACACTGTGGACTCGCGGAGAAGCAGCATTGTGGACCTGTCAACCCACTTCTCGGTGCAGCTACACCTACAGGCAACAACAAAAGACGGAAACTCTGTAGTGGTAACACTACGCCTATAATACATTTAAAAGGTGACAGA-3’(SEQ ID No:1)

[0056] (1) Primer design:

[0057] HPV18 sense primer: 5'-AGCTACAGCArCrArCrCrCrCrCrTrCrACCGTATTCCA-3' (SEQ IDNo: 2);

[0058] HPV18 antisense primer: 5'-GCGAGTCCACrArGrTrGrTrCrCrArGrGTCGTGTAGCA-3' (SEQ IDNo: 3)

[0059] The deoxyribonucleotides at positions 10-19 at the 5' end of the above primers are su...

Embodiment 2

[0061] Example 2 Amplification of Human Papillomavirus 18 Subtypes Added with Special Fluorescent Probes

[0062] (1) Primer design:

[0063] HPV18 sense primer: 5'-AGCTACAGCArCrArCrCrCrCrCrTrCrACCGTATTCCA-3' (SEQ IDNo: 2)

[0064] HPV18 antisense primer: 5'-GCGAGTCCACrArGrTrGrTrCrCrArGrGTCGTGTAGCA-3' (SEQ IDNo: 3)

[0065] The deoxyribonucleotides at positions 10-19 at the 5' end of the above primers are substituted by ribonucleotides.

[0066] HPV18 probe:

[0067] 5'-Quencher-AAGTAGGTGA-CGTGTCCGTGGGCACCGCAAAGACCTACG-TCACCTACTT-FAM-3' (SEQ ID No: 4)

[0068] The above sense primers, antisense primers and fluorescent probes containing endoribonuclease recognition sites are used for real-time isothermal amplification reaction. The volume of the amplification reaction solution is 25 μl, and the amplification reaction solution includes: 20mM Tris-HCl, 10mM (NH4)2SO4, 10mM KCl, 4mM MgSO4, 0.1% Triton X-100, 0.4mM dNTP, 0.2M Betaine, HPV18 fluorescent FAM Probe, 1.6 μM HPV18 ...

Embodiment 3

[0069] Example 3 Simultaneous detection of multiple target genes in one tube reaction

[0070] Taking human papillomavirus subtype 18 and subtype 16 as an example, the constant temperature strand displacement amplification technique described in the present invention is used to amplify both.

[0071] HPV16 DNA fragments:

[0072] 5'-AGACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAACCATAATCTACCATGGCTGATCCTGCAGGTACCAATGGGGAAGAGGGTACGGGATGTAATGGATGGTTTTATGTAGAGGCTGTAGTGGAAAAAAAAAACAGGGGATGCT-3' (SEQ ID No: 5)

[0073] (1) Primer design

[0074] HPV16 sense primer: 5'-CCCCATCTGTrCrTrCrArGrArArArCCATAATCTAC-3' (SEQ IDNo: 6)

[0075] HPV16 antisense primer: 5'-CTCTACATAArArArCrCrArTrCrCrArTTACATCCCGT (SEQ ID No: 7);

[0076] HPV16 probe:

[0077] 5'-Quencher-TTGATGGAGT-TGGCTGATCCTGCAGGTACCAATGGGGA-ACTCCATCAA-HEX-3' (SEQ ID No: 8)

[0078] HPV18 sense primer: 5'-AGCTACAGCArCrArCrCrCrCrCrTrCrACCGTATTCCA-3' (SEQ IDNo: 2)

[0079] HPV18 antisense primer: 5'-GCGAGTCCACrArGrTrGrTr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a thermostatic strand displacement amplification technology. According to the technology, after heating denaturation is conducted on a target DNA sequence, a pair of primers containing RNA sequences are used for hybridizing with a template DNA single chain, the primers are extended under the action of strand displacement DNA polymerase, a combined sequence of target DNA andRNA containing an identification site of endoribonuclease is generated, the identification site is cut by the hydrolyzation of thermal resistant endoribonuclease to form viscous termini, the primersare connected with the viscous termini, a 3' terminus is extended under the action of the strand displacement DNA polymerase and replaces another DNA strand, a displaced strand is sequentially turnedinto target sources of another amplification reaction after the displaced strand is hybridized with the primers, the steps are constantly repeated in a reaction system, and the target DNA sequence isincreased in exponential rate. The technology is convenience, sensitive, rapid and good in specificity, the detecting lower limit is DNA with a plurality of gene copy numbers, the technical detect ofthermostatic amplification in the prior art is overcome, and the technology can be widely applied to the fields of clinical medicine, medical jurisprudence, animal and plant quarantine inspection andthe like.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a novel constant temperature strand displacement amplification technology and a kit. Background technique [0002] The modern molecular diagnostics industry is worth £20 billion and is growing at 20% per annum. Nucleic acid amplification technology is an important research method in the field of molecular biology. PCR (polymerase chain reaction, Science, 230, 1350-1354, 1985) is the most common technical method for amplifying nucleic acid sequences in vitro. On this basis, it is divided into two categories: variable temperature amplification technology and isothermal amplification technology. At present, variable temperature amplification technologies mainly include ordinary PCR, nested PCR, multiplex PCR, real-time fluorescent quantitative PCR, etc. These technologies play an important role in clinical medicine, laboratory medicine, genomics detection and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2531/119C12Q2521/327C12Q2521/101
Inventor 贠红岩张益宇张翰笙
Owner 贠红岩
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap