Gaucher lentiviral vector, lentivirus and preparation method and application thereof

A lentiviral vector and lentivirus technology, applied in the field of genetic engineering, can solve the problems of unclear specific factors and harm, and achieve the effects of strong stability, high transfection efficiency and good safety.

Inactive Publication Date: 2018-10-30
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, AAV vectors will generate host immune responses in the human body, and the degree of immune responses injected into different tissues is also different. The specific factors and hazards are still unclear, which will be the key to its clinical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gaucher lentiviral vector, lentivirus and preparation method and application thereof
  • Gaucher lentiviral vector, lentivirus and preparation method and application thereof
  • Gaucher lentiviral vector, lentivirus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Construction of lentiviral vector

[0070] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0071] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:

[0072] Modification of the 5' splice donor site:

[0073] Wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0074] Mutant (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0075] (2) Insertion of promoter and GBA gene:

[0076] Synthesize the normal GBA gene sequence (as shown in SEQ ID NO.1) an...

Embodiment 2

[0081] Example 2 Preparation and identification of lentivirus

[0082] 1) Preparation of lentivirus

[0083] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0084] (1) The lentiviral vector constructed in Example 1 and the packaging helper plasmid pNHP and pHEF-VSV-G were co-transfected into mammalian cells HEK293T and cultured for 24-72h;

[0085] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.

[0086] 2) Identification of lentivirus

[0087] The collected cells after transfection with normal GBA gene lentivirus were identified for protein expression to clarify the expression of GBA gene in the cells.

[0088] From the results, there is no expression of GBA protein in the negative control cells without lentivirus transfection, but a significantly larger amount of GBA protein exp...

Embodiment 3

[0090] Example 3 Therapeutic effect of lentivirus

[0091] The schematic diagram of the treatment process for the treatment of Gaucher's disease with the dual stem cell system obtained by transfecting the lentiviral vector of the present invention with normal GBA prepared in Example 2 is as follows Figure 4 As shown, after mobilizing the patient's stem cells, the patient's peripheral blood was collected and the hematopoietic stem cells and mesenchymal stem cells were separated, and the double stem cells were transfected with the lentiviral vector carrying the normal GBA gene to obtain the stem cells carrying the normal GBA gene, and the cells were injected intravenously. The way to inject it back into the patient's body for disease treatment.

[0092] It can be seen from the results that after direct injection of lentivirus, the delivery efficiency and expression level of GBA gene can be effectively improved.

[0093] In summary, the lentiviral vector of this application can...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Gaucher lentiviral vector, a lentivirus and a preparation method and application thereof. The lentiviral vector is obtained by modifying a splicing donor site at the terminal5' of a pTYF lentiviral vector and further comprises GBA gene. The GBA gene is specifically connected in on the basis of the lentiviral vector after being modified, so that more efficient genetic transmission can be realized while safety is ensured, expression of the GBA gene in transgenic related cells is improved, and transmission of normal gene in the process of Gaucher gene therapy can be completed more efficiently.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a Gaucher lentiviral vector, a lentivirus and a preparation method and application thereof, in particular to a medicament for treating Gaucher disease by using the improved lentiviral vector to optimize the expression of GBA gene. Background technique [0002] Gaucher's disease (Gaucher's disease) is a genetic disease affecting multiple organs and tissues in the human body. Due to the GBA gene mutation greatly reduces or eliminates the activity of β-glucocerebrosidase, there is not enough β-glucocerebrosidase , glucocerebrosides and related substances reach toxic levels within cells, and tissues and organs are damaged by the abnormal accumulation and storage of these substances, leading to the features of Gaucher disease. Symptoms and signs vary widely from patient to patient. Type I Gaucher disease is the most common form of Gaucher disease. Type I Gaucher disease is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N7/01C12N5/10A61K48/00A61P25/00A61P9/00A61P11/00A61P19/02A61P19/08A61P29/00A61P27/02
CPCA61K48/0008A61P9/00A61P11/00A61P19/02A61P19/08A61P25/00A61P27/02A61P29/00C12N5/0634C12N5/0665C12N15/86C12N2510/00C12N2740/15043A61P7/00A61K35/76C12N2740/16043A61K48/005
Inventor朱章英
OwnerSHENZHEN GENO IMMUNE MEDICAL INST