A mutant of maltooligosaccharide-based trehalose synthase with improved thermostability

A trehalose synthase and malto-oligosaccharide-based technology, which is applied in the fields of enzyme engineering and protein engineering, can solve the problems of poor stability, high cost and poor expression of mesophilic enzymes, and achieve the effects of improving thermal stability and stability.

Active Publication Date: 2021-03-30
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There are two types of maltooligosaccharide-based trehalose synthases, high-temperature enzymes and medium-temperature enzymes. Among them, high-temperature enzymes are poorly expressed in the host, and their specific activity is lower than that of medium-temperature enzymes. However, due to poor stability of medium-temperature enzymes, the conversion temperature cannot be too high , leading to easy bacterial contamination in the reaction, and at the same time, it is necessary to add enzymes in the follow-up, which is costly. Therefore, it is particularly important for the thermostable transformation of mesophilic enzymes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A mutant of maltooligosaccharide-based trehalose synthase with improved thermostability
  • A mutant of maltooligosaccharide-based trehalose synthase with improved thermostability

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Expression of wild-type maltooligosaccharyl trehalose synthase

[0044] Using the Arthrobacter ramosus genome as a template, using the nucleotide sequence as the forward primer of SEQ ID NO.4: CATATGCCAGCTTCTACATAT and the nucleotide sequence as the reverse primer of SEQ ID NO.5: ATTACTGGTTGAAACCtAAAAGCTT to clone the target gene treY containing the coding sequence, After double digestion with HindIII and NdeI, it was ligated with the expression vector pET24a, transferred into the large intestine BL21(DE3), and treY / pET24a / BL21(DE3) was obtained, and treY / pET24a / BL21(DE3) was inoculated in LB liquid medium (containing 100mg / L Kanamycin) was grown for 10 h, and the seeds were inserted into TB liquid fermentation medium (containing 100 mg / L Kanamycin) according to the inoculum size of 5%, and after Escherichia coli engineering bacteria were cultivated at 37° C. for 2 h, 0.01 mmol / L L final concentration of IPTG (isopropylthio-β-D-galactoside) to induce, and co...

Embodiment 2

[0045] Example 2: Preparation and expression of a single mutant of maltooligosaccharyl trehalose synthase of the present invention

[0046] (1) Construction of single mutants G415P and G415D:

[0047] Site-directed mutagenesis: Using PCR technology, using the treY / pET-24a(+) plasmid as a template, the mutation primers are:

[0048] G415P:

[0049]The nucleotide sequence of the forward primer is SEQ ID NO.6: GCTTTCAGCAGACCTCA CCG ATGATCATGGC (the underline is the mutation site)

[0050] The nucleotide sequence of the reverse primer is SEQ ID NO.7: GCCATGATCAT CGG TGAGGTCTGCTGAAAGC (the mutation site is underlined)

[0051] G415D:

[0052] The nucleotide sequence of the forward primer is SEQ ID NO.8: CTTTCAGCAGACCTCA GAT ATGATCATGGC (the underline is the mutation site)

[0053] The nucleotide sequence of the reverse primer is SEQ ID NO.9: GCCATGATCAT ATC TGAGGTCTGCTGAAAG (the mutation site is underlined)

[0054] The PCR system is: 20 μM forward primer and reverse p...

Embodiment 3

[0059] Example 3: Thermal stability analysis of the maltooligosaccharide-based trehalose synthase mutant of the present invention

[0060] The fermented intracellular crude enzyme liquid obtained in Example 1 and Example 2 was purified, and the stability of the purified enzyme was tested.

[0061] Test results such as figure 1 As shown, it can be seen that the half-life of mutant G415P, G415D and wild type is 84h, 11h and 43h respectively, the mutant G415P is 41h higher than the wild type, which is 2 times that of the wild type, and the half-life of G415D is 32h lower than the wild type, which is the wild type. 25%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses thermal stability improved maltooligosyl trehalose synthase mutant and belongs to the technical field of enzyme engineering and protein engineering. The maltooligosyl trehalosesynthase mutant disclosed by the invention is prepared by mutating one amino acid site of maltooligosyl trehalose synthase. Compared with parent maltooligosyl trehalose synthase, the maltooligosyl trehalose synthase mutant has higher stability. Compared with a wild type, a half-life period of the maltooligosyl trehalose synthase mutant disclosed by the invention at 50 DEG C is increased by 41 hours; the half-life period of the maltooligosyl trehalose synthase mutant disclosed by the invention is 2 times of the half-life period of the wild type; namely, compared with the wild type, the stability of the maltooligosyl trehalose synthase mutant disclosed by the invention is improved by twice.

Description

technical field [0001] The invention relates to a maltooligosaccharide-based trehalose synthase mutant with improved thermal stability, which belongs to the technical fields of enzyme engineering and protein engineering. Background technique [0002] Trehalose (Trehalose) is a disaccharide widely present in nature, which is composed of two glucose linked by α,α-1,1-glycosidic bonds, because of its unique high moisture retention, thermal acid stability and safety , are widely used in food, agriculture, medicine, cosmetics. Since the 1980s, countries have successively carried out studies on the physiology, biochemistry and molecular biology of trehalose, and the sugar has now become one of the main oligosaccharides recently developed in the world. The Ministry of Health of my country officially approved trehalose as a new resource food in 2005. [0003] At present, there are three main methods for producing trehalose, which are acidification enzyme method, trehalose synthase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P19/18C12P19/12
CPCC12N9/1051C12N15/70C12P19/12C12P19/18C12Y204/01245
Inventor吴敬宿玲恰陈春封金云
OwnerJIANGNAN UNIV