A mutant of maltooligosaccharide-based trehalose synthase with improved thermostability
A trehalose synthase and malto-oligosaccharide-based technology, which is applied in the fields of enzyme engineering and protein engineering, can solve the problems of poor stability, high cost and poor expression of mesophilic enzymes, and achieve the effects of improving thermal stability and stability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1: Expression of wild-type maltooligosaccharyl trehalose synthase
[0044] Using the Arthrobacter ramosus genome as a template, using the nucleotide sequence as the forward primer of SEQ ID NO.4: CATATGCCAGCTTCTACATAT and the nucleotide sequence as the reverse primer of SEQ ID NO.5: ATTACTGGTTGAAACCtAAAAGCTT to clone the target gene treY containing the coding sequence, After double digestion with HindIII and NdeI, it was ligated with the expression vector pET24a, transferred into the large intestine BL21(DE3), and treY / pET24a / BL21(DE3) was obtained, and treY / pET24a / BL21(DE3) was inoculated in LB liquid medium (containing 100mg / L Kanamycin) was grown for 10 h, and the seeds were inserted into TB liquid fermentation medium (containing 100 mg / L Kanamycin) according to the inoculum size of 5%, and after Escherichia coli engineering bacteria were cultivated at 37° C. for 2 h, 0.01 mmol / L L final concentration of IPTG (isopropylthio-β-D-galactoside) to induce, and co...
Embodiment 2
[0045] Example 2: Preparation and expression of a single mutant of maltooligosaccharyl trehalose synthase of the present invention
[0046] (1) Construction of single mutants G415P and G415D:
[0047] Site-directed mutagenesis: Using PCR technology, using the treY / pET-24a(+) plasmid as a template, the mutation primers are:
[0048] G415P:
[0049]The nucleotide sequence of the forward primer is SEQ ID NO.6: GCTTTCAGCAGACCTCA CCG ATGATCATGGC (the underline is the mutation site)
[0050] The nucleotide sequence of the reverse primer is SEQ ID NO.7: GCCATGATCAT CGG TGAGGTCTGCTGAAAGC (the mutation site is underlined)
[0051] G415D:
[0052] The nucleotide sequence of the forward primer is SEQ ID NO.8: CTTTCAGCAGACCTCA GAT ATGATCATGGC (the underline is the mutation site)
[0053] The nucleotide sequence of the reverse primer is SEQ ID NO.9: GCCATGATCAT ATC TGAGGTCTGCTGAAAG (the mutation site is underlined)
[0054] The PCR system is: 20 μM forward primer and reverse p...
Embodiment 3
[0059] Example 3: Thermal stability analysis of the maltooligosaccharide-based trehalose synthase mutant of the present invention
[0060] The fermented intracellular crude enzyme liquid obtained in Example 1 and Example 2 was purified, and the stability of the purified enzyme was tested.
[0061] Test results such as figure 1 As shown, it can be seen that the half-life of mutant G415P, G415D and wild type is 84h, 11h and 43h respectively, the mutant G415P is 41h higher than the wild type, which is 2 times that of the wild type, and the half-life of G415D is 32h lower than the wild type, which is the wild type. 25%.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

