Thermal stability and trehalose yield improved MTSase mutant

A technology with improved yield and thermal stability, which is applied in the fields of enzyme engineering and protein engineering, can solve the problems of poor enzyme stability at medium temperature, high cost, and high conversion temperature, etc., so as to reduce the amount of enzyme added, improve stability, and produce trehalose The effect of increased conversion rate

Active Publication Date: 2018-11-06
JIANGNAN UNIV
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] There are two types of maltooligosaccharide-based trehalose synthases, high-temperature enzymes and medium-temperature enzymes. Among them, high-temperature enzymes are poorly expressed in the host, and their specific activity is lower than that of medium-temperature enzymes. However, due to poor stability of medium-temperature enzymes, the conversion temperature cannot be too high , leading to easy bacterial contamination in the reaction, and at the same time, the subsequent addition of enzymes is costly, so it is particularly important for the thermal stability and activity modification of medium-temperature enzymes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermal stability and trehalose yield improved MTSase mutant
  • Thermal stability and trehalose yield improved MTSase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Expression of wild-type maltooligosaccharyl trehalose synthase

[0044] The Arthrobacter ramosus genome was used as a template, and the nucleotide sequence was SEQ ID NO.4: the forward primer of CATATGCCAGCTTCTACATAT and the nucleotide sequence was SEQ ID NO.5: the reverse primer of ATTACTGGTTGAAACCTAAAAGCTT was used to clone the target gene treY containing the coding sequence, after After HindIII and NdeI double digestion, it was ligated with the expression vector pET24a, transformed into Escherichia coli BL21(DE3), and treY / pET24a / BL21(DE3) was obtained, and treY / pET24a / BL21(DE3) was inoculated in LB liquid medium (containing 100mg / L Kanamycin) was grown for 10 h, and the seeds were inserted into TB liquid fermentation medium (containing 100 mg / L Kanamycin) according to the inoculum size of 5%, and after Escherichia coli engineering bacteria were cultivated at 37° C. for 2 h, 0.01 mmol / L L final concentration of IPTG (isopropylthio-β-D-galactoside) to indu...

Embodiment 2

[0045] Example 2: Preparation and expression of a single mutant of maltooligosaccharyl trehalose synthase of the present invention

[0046] (1) Construction of single mutants S44P, L26F, T413Y:

[0047] Site-directed mutagenesis: Using PCR technology, using the treY / pET-24a(+) plasmid as a template, the mutation primers are:

[0048] S44P:

[0049] The nucleotide sequence of the forward primer is SEQ ID NO.6: CCTCTGTTAGAAAGTGAA CCA GGTTCTTCAC (the mutation site is underlined)

[0050] The nucleotide sequence of the reverse primer is SEQ ID NO.7: GTGAAGAACC TGG TTCACTTTCTAACAGAGG (underline is the mutation site)

[0051] L26F:

[0052] The nucleotide sequence of the forward primer is SEQ ID NO.8: CAGCCCGTATTGTTCCATAT TTT CATCGTTTAGGC (the mutation site is underlined)

[0053] The nucleotide sequence of the reverse primer is SEQ ID NO.9: GCCTAAACGATG AAA ATATGGAACAATACGGGCTG (the mutation site is underlined)

[0054] T413Y:

[0055] The nucleotide sequence of the for...

Embodiment 3

[0062] Example 3: Thermal stability analysis of the maltooligosaccharide-based trehalose synthase mutant of the present invention

[0063] The fermented intracellular crude enzyme liquid obtained in Example 1 and Example 2 was purified, and the stability of the purified enzyme was tested.

[0064] Test results such as figure 1 As shown, it can be seen that the half-lives of mutant S44P, L26F, T413Y and wild type are 55h, 40h, 15h and 43h respectively, the mutant S44P is 12h higher than the wild type, which is 1.3 times that of the wild type, and the half-life of the mutant L26F and T413Y is longer than the wild type Type reduction, respectively reduced by 3h, 28h.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses thermal stability and trehalose yield improved MTSase mutant and belongs to the technical field of enzyme engineering and protein engineering. The maltooligosyl trehalose synthase mutant disclosed by the invention is prepared by mutating one amino acid site of maltooligosyl trehalose synthase. Compared with parent maltooligosyl trehalose synthase, the prepared maltooligosyltrehalose synthase has higher thermal stability, a lower enzyme adding amount and a higher trehalose producing conversion rate. Compared with a wild type, a half-life period of the maltooligosyl trehalose synthase mutant disclosed by the invention at 50 DEG C is increased by 12 hours, and the half-life period of the maltooligosyl trehalose synthase mutant disclosed by the invention is 1.3 times of the half-life period of the wild type.

Description

technical field [0001] The invention relates to an MTSase mutant with improved thermostability and trehalose yield, belonging to the technical fields of enzyme engineering and protein engineering. Background technique [0002] Trehalose (Trehalose) is a disaccharide widely present in nature, which is composed of two glucose linked by α,α-1,1-glycosidic bonds, because of its unique high moisture retention, thermal acid stability and safety , are widely used in food, agriculture, medicine, cosmetics. Since the 1980s, countries have successively carried out studies on the physiology, biochemistry and molecular biology of trehalose, and the sugar has now become one of the main oligosaccharides recently developed in the world. The Ministry of Health of my country officially approved trehalose as a new resource food in 2005. [0003] At present, there are three main methods for producing trehalose, which are acidification enzyme method, trehalose synthase single-enzyme method, M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/12
CPCC12N9/1051C12P19/12C12Y204/01245
Inventor吴敬宿玲恰陈春封金云
OwnerJIANGNAN UNIV