Reagent kit for detecting pathologic myopia and use method and purpose of reagent kit

A kit and pathological technology, applied in the field of kits for detecting pathological myopia, can solve the problems of not being able to effectively control the development of myopia, increase vision, etc., and achieve the advantages of new drug development, strong specificity, and good market application prospects Effect

Active Publication Date: 2019-04-12
QINGDAO UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Optical corrective glasses help to increase vision but cannot effectively control the development of myopia; surgical control of axial lengthening and vitreous surgery laser treatment can only delay the progress of the disease, and it is accompanied by certain risks and damages. The long-term effect also to be verified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for detecting pathologic myopia and use method and purpose of reagent kit
  • Reagent kit for detecting pathologic myopia and use method and purpose of reagent kit
  • Reagent kit for detecting pathologic myopia and use method and purpose of reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Detection of KIAA1462 gene mutation

[0033] An autosomal dominant 5-generation pedigree strictly followed the diagnostic criteria: ① myopia ≤ -6.0D; ② characteristic fundus changes including optic disc arc spot, leopard pattern fundus, macular degeneration and posterior staphyloma; ③ The age of onset is before elementary school; ④ myopia progressively deepening; Myopia, that is, patients diagnosed as pathological myopia; ①② is a necessary condition. After the phenotype was determined, family investigation and collection were carried out. Genealogy maps were generated using Cyrillic software.

[0034] Collect the peripheral blood of at least three patients and one normal immediate relative in the family, extract genomic DNA, use the Agilent Human All Exon Kit exome capture chip, prepare a cluster for data processing, and then find three patients through bioinformatics analysis The total number of mutations in the database is about 2-5 thousand, and the public databas...

Embodiment 2

[0037] A kit for detecting pathological myopia of the present invention, the kit includes reagents for amplifying the gene fragment at the c.3385th gene site of the third exon of the KIAA1462 gene; the reagents include a pair of primers, and the pair of primers The sequence of the sense primer is: TGGGCGAGATAGCAACTCTT, and the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA. The reagent also includes buffer, mixed solution, magnesium chloride solution, Taq enzyme with a concentration of 1U / μL, DNA template with a concentration of 30ng / μL and double distilled water, the buffer is PCR Buffer, and the mixed solution is dNTP mixture. Wherein, each component and dosage in the reagent are shown in Table 1.

[0038] The composition of table 1 reagent

[0039] serial number

Embodiment 3

[0041] A method for using a test kit for detecting pathological myopia of the present invention comprises the following steps:

[0042] 1) Genomic DNA extraction: Use the QIAamp DNABlood Mini Kit kit from QIAGEN to extract peripheral blood genomic DNA; dissolve the obtained DNA in TE for storage, correct the DNA working concentration to 30ng / μL, and store in a -20°C refrigerator;

[0043] 2) PCR amplification: Take the kit, the composition of 25 μL PCR reaction system is shown in Table 1, the sequence of the sense primer is: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA; the conditions for PCR amplification are: 95 ℃, 5min; 95℃, 30s, 65℃, 45s, 72℃, 45s, 35 cycles; 72℃, 10min; 4℃, keep warm to get the PCR product;

[0044] 3) PCR product purification: Take 5 μL of the PCR product obtained in step 2), add 1 μL of ExoSAP-IT (US PCR purification reagent) from USB Company, and perform a purification reaction. The conditions o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a reagent kit for detecting pathologic myopia and a use method and purpose of the reagent kit. The reagent kit comprises a reagent for amplifying a genetic fragment at the c.3385th gene site of the 3rd exon of a KIAA1462 gene, wherein the reagent comprises a primer pair, the sequence of an upstream primer of the primer pair is TGGGCGAGATAGCAACTCTT, and the sequence of a downstream primer of the primer pair is GAGGTTAGCAACGGAATGGA. The reagent kit disclosed by the invention is high in sensitivity and high in specificity; whether the mutation site is variated or not can bedetermined only through few DNA samples, and whether the result belongs to the type of the pathologic myopia or not can be obtained only through detecting one gene site, so that the reagent kit is convenient to use and simple to operate; and the purpose of early-stage screening can be achieved, development of new medicines is facilitated, and the reagent kit has favorable market application prospects.

Description

technical field [0001] The invention relates to the technical field of medical kits, in particular to a kit for detecting pathological myopia and its use method and application. Background technique [0002] Pathologic myopia (Pathologic Myopia, PM) refers to the diopter ≤ -6.0D, accompanied by axial extension, retinal choroidal degeneration is characterized by refractive errors. In addition to vision loss, it is often accompanied by some complications such as cataract, amblyopia, macular degeneration and retinal detachment, which are important causes of blindness. According to statistics, especially in East Asian countries including mainland China, Hong Kong and Taiwan, the incidence of myopia has increased sharply in recent years. At present, 80-90% of students suffer from myopia, of which 10-20% are high myopia. Pathological myopia has an incidence rate of 1% in the general population and has become an important cause of blindness. It is estimated that the number of myo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6869
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2531/113
Inventor 于常红周宇梁涛张心华纪静常文光朱元镇
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap