A kind of long non-coding RNA and its application in the preparation of diagnosis of preeclampsia and target drug treatment
A technology for preeclampsia and diagnosis, applied in the field of genetic engineering, can solve the problems of lack of effective and effective measures, unclear molecular mechanism, and unclear pathogenesis.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Detection of the expression of Linc00284 in placental tissue
[0051] Take 0.1g tissue, grind it sufficiently with liquid nitrogen (into a powder form) or discard the culture medium for 1-5×107 cells, and rinse twice with pre-cooled PBS. Add 1ml of Trizol lysate, pipette and mix with an enzyme-free pipette tip, let stand for 5min, and transfer the lysate into a pre-labeled 1.5ml enzyme-free centrifuge tube. Centrifuge at 7500g at 4°C for 5 minutes, take the supernatant and add 1 / 5 volume of chloroform, invert and mix for 30 seconds, and let stand for 2 minutes. Centrifuge at 12000g for 15min at 4°C. Transfer the aqueous layer to a new 1.5ml centrifuge tube. Add an equal volume of isopropanol, mix gently by inversion, and let stand for 5-10min. Centrifuge at 12000g for 10min at 4°C. Discard the supernatant, add 1ml of 75% ethanol (prepared now), and wash the RNA pellet. Centrifuge at 7500g at 4°C for 5min, discard the supernatant. Try to remove 75% alcohol and dry ...
Embodiment 2
[0068] To study the effect of Linc00284 on the function of HTR-8 / SVneo cells.
[0069] First, the normal trophoblast HTR-8 / SVneo cell line was selected as the research object of this experiment, and lip2000 was used as the transfection reagent carrier to transfect the Linc00284 interference sequence si-Linc00284 1#GAGAAAUAGUCUGUGUUGCCCUGA to effectively knock down the expression of Linc00284, and the MTT assay It was found that knockdown of Linc00284 expression in HTR-8 / SVneo cells promoted cell growth. ( figure 2 A). In addition, overexpression of Linc00284 inhibited the growth of HTR-8 / SVneo cells ( figure 2 B). Thus, these data indicate that Linc00284 can inhibit the proliferation ability of HTR-8 / SVneo cells.
Embodiment 3
[0071] Effect of Linc00284 on trophoblast apoptosis
[0072] Flow cytometry Annexin V / PI double staining method to measure cell apoptosis: In order to study whether Linc00284 affected the proliferation of HTR-8 / SVneo cells cell cycle transition, the normal trophoblast HTR-8 / SVneo cell line was used as the research object, Using Furgern as a vector, the Linc00284 plasmid was transfected to overexpress the expression of Linc00284.
[0073] 1) Cell collection: Suspension cells are directly collected into a 10ml centrifuge tube, while adherent cells are first blown gently with a dropper. Apoptotic cells may detach after being blown, so they are collected into a 10ml centrifuge tube. Cells that do not detach Digest it with 0.02% EDTA to detach it, and the number of cells per sample is (1~5)×10 6 , 500 ~ 1000r / min centrifuge 5min to discard the culture medium.
[0074] 2) Wash once with incubation buffer, centrifuge at 500-1000r / min for 5min.
[0075] 3) Resuspend the cells with ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More