Recombinant dgkk gene for fragile x syndrome gene therapy
A functional, homogeneous technology with application in the medical field to address issues such as treatments that have not shown benefit in Fragile X Syndrome
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0178] Example 1: Identification of regions involved in the control of Dgkk expression by FMRP in Cos-1 cells.
[0179] Materials and Methods
[0180] Cell culture: COS cells ( CRL-1650 TM ) in the presence of antibiotics at 37°C, 5% CO 2 , grown in DMEM supplemented with 10% fetal bovine serum, 1 g / l glucose. The day before transfection, 4x10 4 Cells were seeded into 24-well plates in 500 μl of antibiotic-free medium.
[0181] Plasmid Construction: Mouse DgkKappa was subcloned from clone IMAGE IRAVp968H03163D. Using primers GCAGCTAGCTCCTTGAAAGCTGGAAGGAGA (SEQ ID No: 2) and AATAGAATGCGGCCGCCAGCTTCAACAGCACTTGTAG (SEQ ID No: 3) to clone the missing Dgkκ 3'UTR region from mouse genomic DNA by PCR, and introduce it into the XbaI and NotI sites of the pYX-Dgkκ vector to obtain pYX-DgkκFull. Using pCI-DgkκFull as template (obtained by subcloning Dgkk into pCI vector GenBank U47119) and by using primers sense (TTCTCAACTATACCCATACGATGTTCCCAGATTACGCTTAGTCCTTG-AAAGCTGGAAGG, SEQ ...
Embodiment 2
[0205] Example 2: Modulation of expression of Δ5'-Dgkκ for dendritic spine modification and rescue.
[0206] Materials and Methods
[0207] AAV vector construction: a short hairpin RNA designed to target Dgkk (shRNA Dgkk, 5'-GGAATGCACTACTGGTATTCC, SEQID No: 6) and a selected shRNA-scramble sequence that did not match in computer simulations in the mouse genome ( 5'-GCGCTTAGCTGTAGGATTC, SEQ ID No: 7), which was cloned under the control of the mU6 promoter into a pAAV-MCS-derived plasmid expressing enhanced green fluorescent protein (EGFP) under the control of the CMV promoter. Overexpression of Dgkk was achieved by cloning HA-tagged Δ5'reg-Dgkk under the control of the human Synapsin-1 gene promoter, which replaces the control plasmid pENN.AAV.hSynapsin1.EGFP.RBG (provided by Penn, University of Pennsylvania). EGFP in Vector Core). Generation of recombinant adeno-associated virus serotype 9 (AAV9) co-expressing EGFP and shRNA (AAV9-EGFP-shRNA-Dgkk and control AAV9-EGFP-shRNA-...
Embodiment 3
[0211] Example 3: Transduction of AAVΔ5'reg-Dgkκ in vitro and in vivo, and effects on behavior of Fmrl-KO mice.
[0212] Materials and Methods
[0213]AAV vector construction: As described in Example 2, Δ5′reg- Dgkk recombinant adeno-associated virus serotype 9 (AAV9) and RH10 (AAV10).
[0214] Primary cortical neuron cultures: Cortex from C57BL / 6J Fmr1+ / y or Fmr1- / y mouse embryos [embryonic day (E17.5)] in 1xPBS, 2.56mg / mL D-glucose, 3mg / mL BSA and Dissect in 1.16mM MgSO4; incubate with 0.25mg / mL trypsin and 0.08mg / mL DNase I for 20 min; 4 Mechanical dissociation was performed after medium supplementation. Cells were seeded on poly-L-lysine hydrobromide-coated six-well culture plates for 8 days in Neurobasal medium (GIBCO) supplemented with B27, penicillin / streptomycin, and 0.5 μM L-glutamine .
[0215] Stereotaxic surgery and AAV injection: Mice (C57BL / 6J) were treated with ketamine / xylazine (Virbac / Bayer, 100 / 10mg / kg, 10mL / kg) dissolved in sterile isotonic saline (NaCl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


