Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant dgkk gene for fragile x syndrome gene therapy

A functional, homogeneous technology with application in the medical field to address issues such as treatments that have not shown benefit in Fragile X Syndrome

Pending Publication Date: 2019-08-23
UNIVERSITY OF STRASBOURG +2
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] There are currently no treatments shown to be specifically beneficial for Fragile X Syndrome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant dgkk gene for fragile x syndrome gene therapy
  • Recombinant dgkk gene for fragile x syndrome gene therapy
  • Recombinant dgkk gene for fragile x syndrome gene therapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0178] Example 1: Identification of regions involved in the control of Dgkk expression by FMRP in Cos-1 cells.

[0179] Materials and Methods

[0180] Cell culture: COS cells ( CRL-1650 TM ) in the presence of antibiotics at 37°C, 5% CO 2 , grown in DMEM supplemented with 10% fetal bovine serum, 1 g / l glucose. The day before transfection, 4x10 4 Cells were seeded into 24-well plates in 500 μl of antibiotic-free medium.

[0181] Plasmid Construction: Mouse DgkKappa was subcloned from clone IMAGE IRAVp968H03163D. Using primers GCAGCTAGCTCCTTGAAAGCTGGAAGGAGA (SEQ ID No: 2) and AATAGAATGCGGCCGCCAGCTTCAACAGCACTTGTAG (SEQ ID No: 3) to clone the missing Dgkκ 3'UTR region from mouse genomic DNA by PCR, and introduce it into the XbaI and NotI sites of the pYX-Dgkκ vector to obtain pYX-DgkκFull. Using pCI-DgkκFull as template (obtained by subcloning Dgkk into pCI vector GenBank U47119) and by using primers sense (TTCTCAACTATACCCATACGATGTTCCCAGATTACGCTTAGTCCTTG-AAAGCTGGAAGG, SEQ ...

Embodiment 2

[0205] Example 2: Modulation of expression of Δ5'-Dgkκ for dendritic spine modification and rescue.

[0206] Materials and Methods

[0207] AAV vector construction: a short hairpin RNA designed to target Dgkk (shRNA Dgkk, 5'-GGAATGCACTACTGGTATTCC, SEQID No: 6) and a selected shRNA-scramble sequence that did not match in computer simulations in the mouse genome ( 5'-GCGCTTAGCTGTAGGATTC, SEQ ID No: 7), which was cloned under the control of the mU6 promoter into a pAAV-MCS-derived plasmid expressing enhanced green fluorescent protein (EGFP) under the control of the CMV promoter. Overexpression of Dgkk was achieved by cloning HA-tagged Δ5'reg-Dgkk under the control of the human Synapsin-1 gene promoter, which replaces the control plasmid pENN.AAV.hSynapsin1.EGFP.RBG (provided by Penn, University of Pennsylvania). EGFP in Vector Core). Generation of recombinant adeno-associated virus serotype 9 (AAV9) co-expressing EGFP and shRNA (AAV9-EGFP-shRNA-Dgkk and control AAV9-EGFP-shRNA-...

Embodiment 3

[0211] Example 3: Transduction of AAVΔ5'reg-Dgkκ in vitro and in vivo, and effects on behavior of Fmrl-KO mice.

[0212] Materials and Methods

[0213]AAV vector construction: As described in Example 2, Δ5′reg- Dgkk recombinant adeno-associated virus serotype 9 (AAV9) and RH10 (AAV10).

[0214] Primary cortical neuron cultures: Cortex from C57BL / 6J Fmr1+ / y or Fmr1- / y mouse embryos [embryonic day (E17.5)] in 1xPBS, 2.56mg / mL D-glucose, 3mg / mL BSA and Dissect in 1.16mM MgSO4; incubate with 0.25mg / mL trypsin and 0.08mg / mL DNase I for 20 min; 4 Mechanical dissociation was performed after medium supplementation. Cells were seeded on poly-L-lysine hydrobromide-coated six-well culture plates for 8 days in Neurobasal medium (GIBCO) supplemented with B27, penicillin / streptomycin, and 0.5 μM L-glutamine .

[0215] Stereotaxic surgery and AAV injection: Mice (C57BL / 6J) were treated with ketamine / xylazine (Virbac / Bayer, 100 / 10mg / kg, 10mL / kg) dissolved in sterile isotonic saline (NaCl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a nucleic acid coding for a human DGKk protein lacking a functional Proline Rich Region and / or a functional EPAPE repeated Region, and to its use in the treatment of fragile X syndrome in a patient in needs thereof.

Description

[0001] field of invention [0002] The present invention relates to the field of medicine, especially fragile X syndrome. It provides a new treatment for Fragile X Syndrome. Background technique [0003] Fragile X syndrome (FXS) is a genetic disorder that causes intellectual disability, behavioral and learning challenges, and multiple physical traits. Although Fragile X syndrome occurs in both sexes, men are more likely to be affected (1 in 4,000) than women (1 in 8,000) and generally have a higher severity. [0004] Affected individuals usually experience delayed development of speech and language by the age of 2 years. Most males with Fragile X syndrome have mild to moderate intellectual disability, while about one third of affected females are intellectually disabled. Children with Fragile X syndrome may also have anxiety and hyperactive behaviors, such as restlessness or impulsive behavior. They may suffer from attention deficit disorder (ADD), which includes impaired ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12A61K38/00
CPCA61K38/00C12N9/1205A61K31/426A61K31/427A61K31/4439A61K31/506A61K38/45C12Y207/01107A61P25/14A61P25/28A61P43/00C12N15/52C12N15/8645A61K48/00C12N15/86A61K48/0066C12N7/00C12N2750/14143
Inventor H·穆瓦纳R·塔贝
Owner UNIVERSITY OF STRASBOURG