Precise and efficient editing method of upland cotton genome
A genome editing and gene editing technology, applied in the field of precise and efficient editing of the upland cotton genome, can solve the problems of complex and huge genome, and no reports of allotetraploid cotton, etc., and achieve highly specific effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1: Amplification of LbCpf1-NLS-3xHA target sequence
[0037] The target sequence LbCpf1-NLS-3xHA (sequence listing is shown as SEQ ID NO: 4) was obtained by PCR amplification using the pHUN611 vector (sequence listing as SEQ ID NO: 2) as a template. The primers for amplification are:
[0038] LbCpf / F:AAAAAGCAGGCTTCGAAATGTCCAAGCTGGAGAAGTTTACA,
[0039] and LbCpf / R:GAAAGCTGGGTCTAGATTAGGCATAGTCGGGGACATC;
[0040] The PCR reaction system is shown in Table 1.
[0041] Table 1 PCR reaction system of LbCpf1-NLS-3xHA sequence
[0042]
Embodiment 2
[0043] Embodiment 2: Construction of transformation vector GhRBE3
[0044] Carry out double enzyme digestion of pRGEB32-GhU6.7-NPTⅡ (see SEQ ID NO: 1 for the sequence list), and the enzyme digestion system is shown in Table 2. Digest for 5 hours at 37°C, and observe the digested product by gel electrophoresis. Add 4 μL of BstbI, digest at 65°C for 20 minutes, observe whether the digested bands are correct by gel electrophoresis, and then purify the digested products using a gel recovery kit (purchased from OMEGA, Cat. No. D2500-02). See Table 2 for enzyme digestion system.
[0045] Table 2 Enzyme digestion system of pRGEB32-GhU6.7-NPTⅡ
[0046]
[0047] The digested pRGEB32-GhU6.7-NPTII vector and the LbCpf1-NLS-3xHA fusion protein fragment were ligated with the ClonExpress II One Step Cloning Kit (Vazyme C112-02), transformed into Escherichia coli competent, and positive clones were picked for After sequencing, the plasmid with the correct sequence was named GhRBE3 plasm...
Embodiment 3
[0051] Embodiment 3: Construction of GhRBE3-crRNA carrier
[0052] 1. crRNA design of GhCLA gene
[0053] The upland cotton 1-deoxyxylulose-5-phosphate synthase (Cloroplasto alterados, CLA) Gh_A10G2292 gene was selected as the verification gene. Using the bioinformatics software sgRNAcas9_3.0.5 (Xie et al 2014), a crRNA target sequence with PAM sequence "-TTTV" was designed in the exon region of the gene, and one crRNA was selected to construct the plant expression vector of the gene editing system. The sequence of the crRNA is shown in Table 4.
[0054] Table 4 The sequence of crRNA
[0055]
[0056] 2. Connection of crRNA to GhRBE3 vector
[0057] The sequence of the target inserted into the GhRBE3 vector is a repeating sequence of tRNA-crRNA-gRNA, and the target sequence is obtained by gene synthesis, and then connected to the GhRBE3 vector after PCR amplification. Now take crRNA as an example for illustration. The primers for PCR are as follows: pRGEB32-7 / S: aagcat...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More