Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene editing vector system based on barley stripe mosaic virus

A technology of gene editing and vector system, applied in the field of gene editing vector system based on barley streak mosaic virus, can solve the problems of limited, loss of virus system movement, etc., and achieve the effect of high editing efficiency

Active Publication Date: 2019-11-19
CHINA AGRI UNIV
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to its design, the motor protein of the virus itself is removed, so that the virus loses the ability to move systematically, so the parts where it can play a role are relatively limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing vector system based on barley stripe mosaic virus
  • Gene editing vector system based on barley stripe mosaic virus
  • Gene editing vector system based on barley stripe mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] This example uses the PDS gene of tobacco benthamiana as the target gene to illustrate the construction and application of a gene editing vector system based on barley stripe mosaic virus.

[0059] 1. Construction

[0060] 1. The three genomic RNAs of barley stripe mosaic virus were cloned into pCB301 through Stu I and BamH I restriction sites, and the products were respectively called pCB301-BSMVα, pCB301-BSMVβ and pCB301-BSMVγ.

[0061] 2. The sgRNA sequence comprises at least two parts, the first part is the so-called spacer part at the 5' end of the sequence, its length is about 20bp, and the other part is the so-called sgRNA backbone part. The backbone part was synthesized by Jinweizhi Company and cloned into the pENTR4-gRNA7 vector.

[0062] 3. Design primers F1 and R1 and submit them to Invitrogen for synthesis. The sequences of the primers are:

[0063] F1: ATACACAAGTTGTGGTGCAAgagaccGAATTCggtctcAGTTTTTAGAGCTAGAAATAGC;

[0064] R1: ATGGGTTAGTTGTGGCAAAAAAAGCACC...

Embodiment 2

[0097] This example uses the tobacco PDS gene as the target gene to illustrate the construction and application of a gene editing vector system based on barley stripe mosaic virus.

[0098] 1. Construction

[0099] The templates involved in the following steps are related to Example 1, and the specific steps are as follows:

[0100] 1. Design primers F7 and R7 and submit them to Invitrogen for synthesis. The sequences of the primers are:

[0101] F7: AAAAAAAAAAAAAATGTTTGATCAGATCATTCAAATCTGATGGTGCCCATC;

[0102] R7: TTACTTAGAAACGGAAGAAGAATCATCACATCCAACAGAAT.

[0103] Using the above pCB301-BSMVγ as a template, the pCB301-BSMVγ was linearized by inverse PCR using primers F7 and R7, and the obtained product was called linearized pCB301-BSMVγ.

[0104] 2. Design primers F8 and R8 and submit them to Invitrogen for synthesis. The sequences of the primers are:

[0105] F8: TCTTCTTCCGTTTCTAAGTAAGGTGCTTGATGCTTTGGATAAGGC;

[0106] R8: GAATGATCTGATCAAACATTTTTTTTTTTTTAAAAAAAGCACCGACT...

experiment example 1

[0118] This experimental example is used to illustrate Example 1 (due to the integration of sgRNA to the vector containing the β chain, the complete vector system of Example 1 is represented by the characteristic vector β-CP-Tgcas-gNbPDS4 in the accompanying drawings and hereinafter) and Example 2 (due to the integration of sgRNA to the carrier containing the γ chain, the complete carrier system of Example 2 is represented by the characteristic carrier γ-gRNA-gNbPDS4 in the accompanying drawings and hereinafter) to the target gene (PDS gene of Nicotiana benthamiana) ) editing effect.

[0119] Inoculate BSMV gene editing vector and transiently express Cas9 protein by Agrobacterium infiltration. The concentration of Agrobacterium inoculated with BSMV and corresponding mutants (β-CP-Tgcas-gNbPDS4 or γ-gRNA-gNbPDS4) is OD 600 =0.3, the Agrobacterium concentration of Cas9 expression vector pHSE401 is OD 600 = 0.5. On the 4th and 7th day after inoculation, the genomic DNA in the i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly discloses a gene editing vector system based on barley stripe mosaic virus. The gene editing vector system comprises artificial plasmids respectively containing RNA[alpha], RNA[beta] and RNA[gamma] of the barley stripe mosaic viruses; and in the RNA[beta] or the RNA[gamma], a desired sgRNA sequence is integrated. The gene editing vector system based on the barley stripe mosaic virus can perform efficient gene editing on genomes of dicotyledons such as nicotiana benthamiana and monocotyledons such as wheat and corn.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a gene editing vector system based on barley stripe mosaic virus. Background technique [0002] In gene editing operations based on CRISPR / Cas9 technology, the editing efficiency of target genes is closely related to the expression levels of Cas9 protein and sgRNA in target cells. Generally, gene editing vectors based on transient expression vectors can be introduced into plant tissues by gene guns, or can be introduced into plants by Agrobacterium-mediated transformation. However, since the transient expression vector itself cannot replicate and transfer in the target cells, the number of cells that can finally obtain sgRNA and Cas9 protein is limited, and in cells that obtain Cas9 protein and sgRNA, the content of both is also limited, so The efficiency of gene editing will be adversely affected. For this reason, it is often necessary to transform a large number of re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N15/8216C12N2310/20C12N15/8213C12N15/8203C12N15/86C12N2770/00043C12N2770/00021C12N15/113C12N2310/12
Inventor 张永亮胡佳成李大伟姜志豪李召雷
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com