Gene editing vector system based on barley stripe mosaic virus
A technology of gene editing and vector system, applied in the field of gene editing vector system based on barley streak mosaic virus, can solve the problems of limited, loss of virus system movement, etc., and achieve the effect of high editing efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] This example uses the PDS gene of tobacco benthamiana as the target gene to illustrate the construction and application of a gene editing vector system based on barley stripe mosaic virus.
[0059] 1. Construction
[0060] 1. The three genomic RNAs of barley stripe mosaic virus were cloned into pCB301 through Stu I and BamH I restriction sites, and the products were respectively called pCB301-BSMVα, pCB301-BSMVβ and pCB301-BSMVγ.
[0061] 2. The sgRNA sequence comprises at least two parts, the first part is the so-called spacer part at the 5' end of the sequence, its length is about 20bp, and the other part is the so-called sgRNA backbone part. The backbone part was synthesized by Jinweizhi Company and cloned into the pENTR4-gRNA7 vector.
[0062] 3. Design primers F1 and R1 and submit them to Invitrogen for synthesis. The sequences of the primers are:
[0063] F1: ATACACAAGTTGTGGTGCAAgagaccGAATTCggtctcAGTTTTTAGAGCTAGAAATAGC;
[0064] R1: ATGGGTTAGTTGTGGCAAAAAAAGCACC...
Embodiment 2
[0097] This example uses the tobacco PDS gene as the target gene to illustrate the construction and application of a gene editing vector system based on barley stripe mosaic virus.
[0098] 1. Construction
[0099] The templates involved in the following steps are related to Example 1, and the specific steps are as follows:
[0100] 1. Design primers F7 and R7 and submit them to Invitrogen for synthesis. The sequences of the primers are:
[0101] F7: AAAAAAAAAAAAAATGTTTGATCAGATCATTCAAATCTGATGGTGCCCATC;
[0102] R7: TTACTTAGAAACGGAAGAAGAATCATCACATCCAACAGAAT.
[0103] Using the above pCB301-BSMVγ as a template, the pCB301-BSMVγ was linearized by inverse PCR using primers F7 and R7, and the obtained product was called linearized pCB301-BSMVγ.
[0104] 2. Design primers F8 and R8 and submit them to Invitrogen for synthesis. The sequences of the primers are:
[0105] F8: TCTTCTTCCGTTTCTAAGTAAGGTGCTTGATGCTTTGGATAAGGC;
[0106] R8: GAATGATCTGATCAAACATTTTTTTTTTTTTAAAAAAAGCACCGACT...
experiment example 1
[0118] This experimental example is used to illustrate Example 1 (due to the integration of sgRNA to the vector containing the β chain, the complete vector system of Example 1 is represented by the characteristic vector β-CP-Tgcas-gNbPDS4 in the accompanying drawings and hereinafter) and Example 2 (due to the integration of sgRNA to the carrier containing the γ chain, the complete carrier system of Example 2 is represented by the characteristic carrier γ-gRNA-gNbPDS4 in the accompanying drawings and hereinafter) to the target gene (PDS gene of Nicotiana benthamiana) ) editing effect.
[0119] Inoculate BSMV gene editing vector and transiently express Cas9 protein by Agrobacterium infiltration. The concentration of Agrobacterium inoculated with BSMV and corresponding mutants (β-CP-Tgcas-gNbPDS4 or γ-gRNA-gNbPDS4) is OD 600 =0.3, the Agrobacterium concentration of Cas9 expression vector pHSE401 is OD 600 = 0.5. On the 4th and 7th day after inoculation, the genomic DNA in the i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


