Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of SNP molecular marker and its application related to the dark spots of chicken powder shell eggs

A technology of molecular markers and dark spots, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., to achieve rapid breeding, reduce the degree of dark spots in chicken powder and shell eggs, and reduce the dark spots of chicken powder and shell eggs Effect

Active Publication Date: 2020-12-01
JIANGSU INST OF POULTRY SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The choice of dark spots must first determine the evaluation scheme of dark spots. At present, a four-level scoring system is mostly used for the measurement of dark spots. However, this method is easily affected by the judgment of different people.
There is no effective selection method for eggshell dark spots in production, either from surface measurement or molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of SNP molecular marker and its application related to the dark spots of chicken powder shell eggs
  • A kind of SNP molecular marker and its application related to the dark spots of chicken powder shell eggs
  • A kind of SNP molecular marker and its application related to the dark spots of chicken powder shell eggs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Genome-wide association analysis

[0041] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.

[0042] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10-6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 407 samples for subsequent analysis.

[0043] (3) Genome-wide association study (GWAS) method: ...

Embodiment 2

[0046] The establishment of the allele detection method of embodiment 2 powder baked egg dark spot index

[0047] (1) A 175bp nucleotide fragment on chromosome 5 is amplified by primers for the target fragment of the SNP marker site significantly related to the dark spot of powder-shell eggs. The upstream and downstream primers for sequence amplification are:

[0048] Upstream primer pinkM-F: TACTGTTCCCACCTCTGCTG (SEQ ID NO.1)

[0049] Downstream primer pinkM-R: ATGTGAGAGCTGGGGATGAG (SEQ ID NO.2)

[0050] (2) PCR amplification:

[0051] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.

[0052] Using the obtained G1 strain chicken genomic DNA as a template, PCR amplification was carried out using primers pinkM-F and pinkM-R.

[0053] The amplification system is as follows:

[0054]

[0055] The PCR reaction procedure is as follows:

[0056]

[0057] (3) Sequenc...

Embodiment 3

[0062] Example 3 Effect Analysis of Molecular Marker SNP rs315949374 G>C Mutation

[0063] A SNP molecular marker provided by the invention for improving the dark spot of chicken powder shell eggs has an SNP effect on the dark spot value on the day of egg laying and 7 days at the age of 52 weeks respectively of 5.10% and 2.41%. Using the SNP marker to perform molecular marker-assisted selection can significantly reduce the dark spot of powder-shelled eggs, and accelerate the eggshell breeding process of local characteristic laying hens.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker related to chick pink-shell egg dark spots, and belongs to the field of molecular markers and genetic breeding. The SNP site of the SNP molecular markeris located at 24359610 site of chromosome 5 of an international chick reference genome GRCg6a Primary Assembly version, and the basic group at the site is G or C. The invention further provides primer combination for detecting the SNP marker and application of the SNP marker. By utilizing the SNP molecular marker and the primer combination, an efficient and accurate molecular mark assisted breeding method for the chick pink-shell egg dark spots can be established, thus the dark spots are effectively selected in a targeted mode, and good genetic progress is obtained; and further, the breeding method of the pink-shell egg dark spots is effectively improved, and development of local characteristic laying hen industry is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to dark spots of chicken powder shell eggs and an application thereof. Background technique [0002] With the rapid development of my country's economy and the improvement of people's consumption level, the demand for local characteristic laying hens is getting higher and higher. The annual breeding volume of local characteristic laying hens in my country has exceeded 200 million, accounting for 10% of the total laying hens. While the market share of local specialty laying hens is increasing, people's requirements for egg quality are getting higher and higher. Eggs with serious dark spots on the market have affected consumers' choices, made consumers less willing to buy, and seriously affected the breeding benefits. [0003] Eggshell dark spot was first proposed by Holst et al. in 1932. Domestic scholars call it thin spot or b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 曲亮王克华马猛沈曼曼窦套存郭军李永峰胡玉萍卢建李尚民王星果
Owner JIANGSU INST OF POULTRY SCI