A kind of SNP molecular marker and its application related to the dark spots of chicken powder shell eggs
A technology of molecular markers and dark spots, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., to achieve rapid breeding, reduce the degree of dark spots in chicken powder and shell eggs, and reduce the dark spots of chicken powder and shell eggs Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Genome-wide association analysis
[0041] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.
[0042] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10-6 SNP markers; BEAGLE v4.0 selects R 2 SNPs >0.5 were filled. Quality control left 435867 SNPs and 407 samples for subsequent analysis.
[0043] (3) Genome-wide association study (GWAS) method: ...
Embodiment 2
[0046] The establishment of the allele detection method of embodiment 2 powder baked egg dark spot index
[0047] (1) A 175bp nucleotide fragment on chromosome 5 is amplified by primers for the target fragment of the SNP marker site significantly related to the dark spot of powder-shell eggs. The upstream and downstream primers for sequence amplification are:
[0048] Upstream primer pinkM-F: TACTGTTCCCACCTCTGCTG (SEQ ID NO.1)
[0049] Downstream primer pinkM-R: ATGTGAGAGCTGGGGATGAG (SEQ ID NO.2)
[0050] (2) PCR amplification:
[0051] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.
[0052] Using the obtained G1 strain chicken genomic DNA as a template, PCR amplification was carried out using primers pinkM-F and pinkM-R.
[0053] The amplification system is as follows:
[0054]
[0055] The PCR reaction procedure is as follows:
[0056]
[0057] (3) Sequenc...
Embodiment 3
[0062] Example 3 Effect Analysis of Molecular Marker SNP rs315949374 G>C Mutation
[0063] A SNP molecular marker provided by the invention for improving the dark spot of chicken powder shell eggs has an SNP effect on the dark spot value on the day of egg laying and 7 days at the age of 52 weeks respectively of 5.10% and 2.41%. Using the SNP marker to perform molecular marker-assisted selection can significantly reduce the dark spot of powder-shelled eggs, and accelerate the eggshell breeding process of local characteristic laying hens.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


