Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP molecular marker related to chicken green shell egg dark spots and application of SNP molecular marker

A technology of molecular markers and dark spots, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as impact, achieve rapid breeding, reduce feeding costs, and reduce green eggshell dark spots. spot effect

Active Publication Date: 2019-11-19
JIANGSU INST OF POULTRY SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The selection of dark spots must first determine the evaluation scheme of dark spots. At present, the measurement of dark spots mostly adopts a four-level scoring system, but this method is easily affected by the judgment of different people.
There is no effective selection method for eggshell dark spots in production, either from surface measurement or molecular markers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to chicken green shell egg dark spots and application of SNP molecular marker
  • SNP molecular marker related to chicken green shell egg dark spots and application of SNP molecular marker
  • SNP molecular marker related to chicken green shell egg dark spots and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Genome-wide association analysis

[0040] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.

[0041] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2SNPs > 0.5 were filled. Quality control left 435867 SNPs and 1075 samples for subsequent analysis.

[0042] (3) Genome-wide association study (GWAS) metho...

Embodiment 2

[0045] The establishment of the allele detection method of embodiment 2 green-egg dark spot index

[0046] (1) A 171bp nucleotide fragment on chromosome 5 is amplified by primers for the target fragment of the SNP marker site significantly related to the green-egg dark spot. The upstream and downstream primers for sequence amplification are:

[0047] Upstream primer greenM-F: CCCTGCCATTTCACTCCCTA (SEQ ID NO.1)

[0048] Downstream primer greenM-R: TCTCATCCCAGTCACTGCAC (SEQ ID NO.2)

[0049] (2) PCR amplification:

[0050] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.

[0051] Using the obtained L3 chicken genomic DNA as a template, PCR amplification was performed using primers greenM-F and greenM-R.

[0052] The amplification system is as follows:

[0053]

[0054] The PCR reaction procedure is as follows:

[0055]

[0056] (3) Sequence sequencing and identi...

Embodiment 3

[0062] Example 3 Effect Analysis of Molecular Marker SNP rs312873273G>C Mutation

[0063] The present invention provides a SNP molecular marker for improving the dark spot of chicken green-egg eggs, and the SNP effect on the eggshell dark spot value phenotype on the day of egg laying and 7 days at the age of 52 weeks is 3.39% and 15.94%, respectively. Using the SNP marker to perform molecular marker-assisted selection can significantly reduce the dark spot index of green-shelled eggs, and accelerate the eggshell breeding process of local characteristic laying hens.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP molecular marker related to chicken green shell egg dark spots, and belongs to the field of molecular markers and genetic breeding. An SNP locus of the SNP molecular marker is located at the 1735865 position of a chromosome 17 of the Primary Assembly version of an international chicken reference genome GRCg6a, and a basic group at the position is G or C. The invention further provides a primer combination used for detecting the SNP marker and application of the primer combination. By using the SNP molecular marker and the primer combination, an efficient and accurate molecular marker assisted breeding method can be established for the chicken green shell egg dark spots so as to effectively select the dark spots in a targeted mode and obtain a good genetic progress, then a breeding method of the green shell egg dark spots is effectively improved, and the development of local characteristic laying hen industry is promoted.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to chicken green-egg dark spots and an application thereof. Background technique [0002] With the rapid development of my country's economy and the improvement of people's consumption level, the demand for local characteristic laying hens is getting higher and higher. The annual breeding volume of local characteristic laying hens in my country has exceeded 200 million, accounting for 10% of the total laying hens. While the market share of local specialty laying hens is increasing, people's requirements for egg quality are getting higher and higher. Eggs with serious dark spots on the market have affected consumers' choices, made consumers less willing to buy, and seriously affected the breeding benefits. [0003] Eggshell dark spot was first proposed by Holst et al. in 1932. Domestic scholars call it thin spot or bottom spot....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 沈曼曼王克华曲亮窦套存郭军李尚民王星果李永峰卢建胡玉萍马猛
Owner JIANGSU INST OF POULTRY SCI