SNP molecular marker related to chicken green shell egg dark spots and application of SNP molecular marker
A technology of molecular markers and dark spots, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as impact, achieve rapid breeding, reduce feeding costs, and reduce green eggshell dark spots. spot effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Genome-wide association analysis
[0040] (1) Collect the venous blood of F2 generation chicken wings, and use the standard phenol-chloroform method to extract genomic DNA. DNA quality detection, concentration determination, etc. were carried out through standard procedures, and finally the OD260 / 280 ratio between 1.8-2.0 was selected as qualified for subsequent tests. The concentration was uniformly diluted to 50ng / μl for genotyping.
[0041] (2) Use Affymetrix's chicken 600K high-density gene chip for genotyping, and refer to the chip manual for genotyping and quality control, mainly including: using APT v1.16.0 for quality control before typing; PLINK v1.90 for genotyping Quality control, reject call rate less than 0.97, deviation from Hardy-Weinberg balance ≤10 -6 SNP markers; BEAGLE v4.0 selects R 2SNPs > 0.5 were filled. Quality control left 435867 SNPs and 1075 samples for subsequent analysis.
[0042] (3) Genome-wide association study (GWAS) metho...
Embodiment 2
[0045] The establishment of the allele detection method of embodiment 2 green-egg dark spot index
[0046] (1) A 171bp nucleotide fragment on chromosome 5 is amplified by primers for the target fragment of the SNP marker site significantly related to the green-egg dark spot. The upstream and downstream primers for sequence amplification are:
[0047] Upstream primer greenM-F: CCCTGCCATTTCACTCCCTA (SEQ ID NO.1)
[0048] Downstream primer greenM-R: TCTCATCCCAGTCACTGCAC (SEQ ID NO.2)
[0049] (2) PCR amplification:
[0050] The reagents in this example were obtained from Nanjing Novizan Company, and the primer synthesis and sequencing were completed by Shanghai Sangong Company.
[0051] Using the obtained L3 chicken genomic DNA as a template, PCR amplification was performed using primers greenM-F and greenM-R.
[0052] The amplification system is as follows:
[0053]
[0054] The PCR reaction procedure is as follows:
[0055]
[0056] (3) Sequence sequencing and identi...
Embodiment 3
[0062] Example 3 Effect Analysis of Molecular Marker SNP rs312873273G>C Mutation
[0063] The present invention provides a SNP molecular marker for improving the dark spot of chicken green-egg eggs, and the SNP effect on the eggshell dark spot value phenotype on the day of egg laying and 7 days at the age of 52 weeks is 3.39% and 15.94%, respectively. Using the SNP marker to perform molecular marker-assisted selection can significantly reduce the dark spot index of green-shelled eggs, and accelerate the eggshell breeding process of local characteristic laying hens.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


