Unlock instant, AI-driven research and patent intelligence for your innovation.

Cas9-mediated gene editing vector and application of hemp bamboo

A gene-mediated technology used in the fields of biotechnology and genetics and breeding

Active Publication Date: 2021-03-26
FUJIAN AGRI & FORESTRY UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] CRISPR (Clustering of Regularly Interspaced Short Palindromic Repeats) / Cas9 provides a straightforward approach to genome editing in many plants but never before in bamboo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9-mediated gene editing vector and application of hemp bamboo
  • Cas9-mediated gene editing vector and application of hemp bamboo
  • Cas9-mediated gene editing vector and application of hemp bamboo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Acquisition of Mazhu PSY1 gene and sgRNA site

[0030] With reference to the known gene sequence of PSY1 in rice, the PSY1 gene blast of Moso bamboo was compared and the primers corresponding to PSY1 of Bamboo edulis were designed, as shown in SEQ ID No.11 and SEQ ID No.12. The full-length sequence of Mazhu PSY1 was cloned, as shown in SEQ ID No.4. Three bamboo PSY1 alleles (DlmPSY1-A, DlmPSY1-B, DlmPSY1-C) were identified and cloned by a homologous cloning strategy. To mutate all DlmPSY1 copies, an sgRNA1 targeting a conserved site in all DlmPSY1 loci was designed . In addition, the present invention also selects the sgRNA2 target region containing 2-3 single nucleotide polymorphisms (SNPs) sites in the spacer regions of the three DlmPSY1 alleles. The sequences of the sgRNA1 and sgRNA2 are as follows:

[0031] sgRNA1:gaggtccggccagcctcccccgg;

[0032] sgRNA2: gcgcggcacctccaggtccttgg.

Embodiment 2

[0033] Construction of embodiment 2 expression vector

[0034] The PUBI-H carrier was introduced by the research group of Professor Liu Yaoguang ( figure 1 ) (Ma X, Zhang Q, Zhu Q, et al. Arobust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants[J]. Molecular plant, 2015, 8(8): 1274-1284. ).

[0035] (1) The target sequence primers are complementary to form double-stranded DNA (sgRNA1 and 2), as shown in SEQ ID No.13~16:

[0036]

[0037] sgRNA1: Target-F: gttgaggtcc ggccagcctc ccc; Target-R: ggggaggctggccggacct;

[0038] sgRNA2: Target-F: gttgcgcggc acctccaggt cct; Target-R: aaacaggacctggaggtgcc gcg.

[0039] The reaction procedure is as follows: 95°C for 5 min, 25°C for 20 min.

[0040] (2) respectively connected to the intermediate carrier, the reaction system is as follows:

[0041]

[0042]The reaction procedure is as follows: 37°C for 5 min, 16°C for 5 min, cycle 10-15 times, and store at 4°C. (3) Nested ...

Embodiment 3

[0056] Embodiment 3 Ma bamboo genetic transformation and mutant plant acquisition

[0057] A: Conversion material

[0058] The MaBamboo callus used in the MaBamboo genetic transformation system was owned by Zhu Qiang’s group of Fujian Agriculture and Forestry University (Ye, S., et al., An Efficient Plant Regeneration and Transformation System of MaBamboo (Dendrocalamus latiflorus Munro) Started from Young Shoot as Explant. Front Plant Sci, 2017. 8: p. 1298.).

[0059] B: Agrobacterium transformation

[0060] The transformation method refers to the method reported by our research group (Ye, S., et al., An Efficient Plant Regeneration and Transformation System of Ma Bamboo (Dendrocalamus latiflorus Munro) Started from Young Shoot as Explant. Front Plant Sci, 2017. 8: p. 1298.), take about 1600 grains of Mazhu callus in good growth state, place them in the EHA105 Agrobacterium suspension with OD=0.6 for 10~20min, blot the excess bacteria liquid with sterile filter paper, and p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a Cas9-mediated dendrocalamus latiflorus gene editing vector and an application thereof. A Crispr / Cas9 dendrocalamus latiflorus expression vector is constructed, a Cas9gene is introduced into dendrocalamus latiflorus through an agrobacterium (EHA105) transformation method, a dendrocalamus latiflorus PSY1 gene is subjected to directional editing, and the method capable of editing the own gene of the dendrocalamus latiflorus to obtain a dendrocalamus latiflorus mutant is provided for the first time. Applicability of CRISPR / Cas9 in bamboo is proved, thereby promoting research and breeding of the bamboo in the future.

Description

technical field [0001] The invention belongs to the fields of biotechnology and genetic breeding, and in particular relates to a Cas9-mediated gene editing carrier of Mazhu, and also relates to the application of the gene editing carrier. Background technique [0002] Bamboo is a special grass species with important economic and ecological value. About 2.5 billion people directly produce and consume bamboo, and the international trade volume reached US$68.8 billion in 2018 (data from the International Bamboo and Rattan Organization). One of the main bamboo species in Asia is Bamboo hexaploid with three subgenomes (2n=72, AABBCC). Although bamboo is agronomically important, it is almost impossible to change the traits of bamboo by traditional breeding because it takes more than 70 years for bamboo to to bloom. Research on bamboo has largely lagged behind due to the lack of effective genetic manipulation tools. [0003] CRISPR (Clustering of Regularly Interspaced Short Pali...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H4/00A01H5/00A01H6/46
CPCA01H4/00C12N9/1085C12N15/113C12N15/8218C12N2310/20
Inventor 朱强叶善汶陈刚
Owner FUJIAN AGRI & FORESTRY UNIV