Cas9-mediated gene editing vector and application of hemp bamboo
A gene-mediated technology used in the fields of biotechnology and genetics and breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Acquisition of Mazhu PSY1 gene and sgRNA site
[0030] With reference to the known gene sequence of PSY1 in rice, the PSY1 gene blast of Moso bamboo was compared and the primers corresponding to PSY1 of Bamboo edulis were designed, as shown in SEQ ID No.11 and SEQ ID No.12. The full-length sequence of Mazhu PSY1 was cloned, as shown in SEQ ID No.4. Three bamboo PSY1 alleles (DlmPSY1-A, DlmPSY1-B, DlmPSY1-C) were identified and cloned by a homologous cloning strategy. To mutate all DlmPSY1 copies, an sgRNA1 targeting a conserved site in all DlmPSY1 loci was designed . In addition, the present invention also selects the sgRNA2 target region containing 2-3 single nucleotide polymorphisms (SNPs) sites in the spacer regions of the three DlmPSY1 alleles. The sequences of the sgRNA1 and sgRNA2 are as follows:
[0031] sgRNA1:gaggtccggccagcctcccccgg;
[0032] sgRNA2: gcgcggcacctccaggtccttgg.
Embodiment 2
[0033] Construction of embodiment 2 expression vector
[0034] The PUBI-H carrier was introduced by the research group of Professor Liu Yaoguang ( figure 1 ) (Ma X, Zhang Q, Zhu Q, et al. Arobust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants[J]. Molecular plant, 2015, 8(8): 1274-1284. ).
[0035] (1) The target sequence primers are complementary to form double-stranded DNA (sgRNA1 and 2), as shown in SEQ ID No.13~16:
[0036]
[0037] sgRNA1: Target-F: gttgaggtcc ggccagcctc ccc; Target-R: ggggaggctggccggacct;
[0038] sgRNA2: Target-F: gttgcgcggc acctccaggt cct; Target-R: aaacaggacctggaggtgcc gcg.
[0039] The reaction procedure is as follows: 95°C for 5 min, 25°C for 20 min.
[0040] (2) respectively connected to the intermediate carrier, the reaction system is as follows:
[0041]
[0042]The reaction procedure is as follows: 37°C for 5 min, 16°C for 5 min, cycle 10-15 times, and store at 4°C. (3) Nested ...
Embodiment 3
[0056] Embodiment 3 Ma bamboo genetic transformation and mutant plant acquisition
[0057] A: Conversion material
[0058] The MaBamboo callus used in the MaBamboo genetic transformation system was owned by Zhu Qiang’s group of Fujian Agriculture and Forestry University (Ye, S., et al., An Efficient Plant Regeneration and Transformation System of MaBamboo (Dendrocalamus latiflorus Munro) Started from Young Shoot as Explant. Front Plant Sci, 2017. 8: p. 1298.).
[0059] B: Agrobacterium transformation
[0060] The transformation method refers to the method reported by our research group (Ye, S., et al., An Efficient Plant Regeneration and Transformation System of Ma Bamboo (Dendrocalamus latiflorus Munro) Started from Young Shoot as Explant. Front Plant Sci, 2017. 8: p. 1298.), take about 1600 grains of Mazhu callus in good growth state, place them in the EHA105 Agrobacterium suspension with OD=0.6 for 10~20min, blot the excess bacteria liquid with sterile filter paper, and p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


