Check patentability & draft patents in minutes with Patsnap Eureka AI!

Droplet digital PCR kit for detecting carp edema virus

A kit and digital technology, applied in the field of inspection and quarantine, can solve the problems of low viral load and missed detection, low sensitivity and low specificity, and achieve the effects of simple operation, good repeatability and good specificity.

Inactive Publication Date: 2020-02-21
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing literature methods still have the problems of missed detection of low viral load and low specificity due to low sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Droplet digital PCR kit for detecting carp edema virus
  • Droplet digital PCR kit for detecting carp edema virus
  • Droplet digital PCR kit for detecting carp edema virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The establishment of embodiment 1 carp edema virus ddPCR detection method

[0041] 1.1 Design and synthesis of primers and probes

[0042] Downloaded 88 CEV P4a gene sequences from different sources from GenBank database, used DNAStar software to compare and analyze the sequences, and used Primer Express 3.0 software to design 3 pairs of primers and probe combinations (as shown in Table 1). In addition, a pair of primers for amplification of P4a gene (CEV-P4a-F1 and CEV-P4a-R1, as shown in Table 1) were designed using Primer Premier 5.0 software to prepare standard DNA of CEV P4a gene, whose sequence is shown in SEQ ID NO. .10 shows:

[0043] gttatcaatgaaatttgtgtattgtgtttttgttagtccaagagttttcttttcatcatttgttaccttttgtagttgtttgatatttgtgataagatttccattagcataaaatccttcccaaatttgagttgaaacatgttttagagttttgtatattgtagcatttcctagtttgtatggcaagaaacaaactctctttactgtaactccttgaggaatctgatctagaattccgcaatatgtaatctcaaatttgtttgtggagtttttgaaatatactacttcatcatacaatcctagaactagagcaagattagaagtcattgtct...

Embodiment 2

[0093] The application of embodiment 2 carp edema virus ddPCR detection method

[0094] 54 koi tissue samples and 97 carp tissue samples collected from Beijing, Hebei, Henan, Inner Mongolia, Heilongjiang, Ningxia and Hunan provinces during 2016-2018. Samples were stored at -80°C.

[0095] 2.1. Sample processing

[0096] The DNA of 151 samples was extracted, and the tissue DNA extraction kit (DNeasy Blood & Tissue Kit) of Qiagen was used. All samples were directly divided into packaging after extraction, part of which was used for direct detection, and the other part was stored at -80°C for future use.

[0097] 2.2 Clinical sample testing

[0098] Nucleic acid quantitative detection was performed on clinical samples using the CEV ddPCR detection method established in Example 1, and parallel detection was performed using the optimized CEV qPCR detection method, and the detection coincidence rates of the two methods were compared. The detected reaction conditions and reaction ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention relates to a droplet digital PCR (Polymerase Chain Reaction) kit for detecting carp edema virus. The kit includes a primer group and a fluorescent probe. The primer group includes an upstream primer of the sequence shown in SEQ ID NO.8 and a downstream primer of the sequence shown in SEQ ID NO.9. The fluorescent probe includes the fluorescent probe sequence shown in SEQ ID NO.5. Whenusing the kit to perform droplet digital PCR, the lowest detection limit of CEV (carp edema virus) is 1.8 copies / muL which is better than the sensitivity (17.6 copies / muL) of the fluorescent quantitation PCR detection method of the CEV; and no cross reaction is found with the nucleic acids of important aquatic animal pathogens like andriasda vidianus ranaviurs (ADRV), bohle virus (BIV), channel catfish virus (CCV) and spring viremia of carp virus (SVCV). The droplet digital PCR kit provided by the invention is of good specificity.

Description

technical field [0001] The invention relates to the field of inspection and quarantine, in particular to a digital PCR kit for detecting carp edema virus. Background technique [0002] Carp edema virus (CEV), also known as carppox virus, belongs to the Poxviridae family, and is a virus that seriously harms carp and koi aquaculture production. Carp edema virus was first reported in Japan in the 1970s. The disease can cause carp edema virus disease (CEVD) and koi sleepy disease (KSD) in farmed koi. The clinical symptoms of diseased fish are gill rot. , Sunken eyes, skin damage, lethargy, etc., the mortality rate is as high as 80%-100%. Since 2012, carp edema virus has been reported in Australia, the United Kingdom, France, Germany, Italy, Poland and India and other countries. It has now spread to my country and caused the disease of farmed carp and koi. According to preliminary investigations, carp edema disease, as a new and exotic disease, has caused more damage to the car...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/701C12Q1/6851
Inventor 王娜吴绍强张舟张旻张文景宏丽张利峰林祥梅徐立蒲
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More