Unlock instant, AI-driven research and patent intelligence for your innovation.

Corynebacterium and colibacillus double expression vector with high copy capability and building method thereof

A technology of coryneform bacteria and Escherichia coli, applied in the biological field, can solve problems such as low copying ability, high cost, and difficulty in large-scale production

Active Publication Date: 2020-04-03
ZHAOQING INST OF BIOTECHNOLOGY CO LTD
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on biological metabolism and bacterial replication of coryneform bacteria is far less in-depth and comprehensive than that of E. The ability to copy directly leads to low yields and thus high costs, making it difficult to use in mass production
[0006] The applicant Tianjin University filed an invention patent application 201910636614.1 on July 15, 2019, disclosing a Corynebacterium glutamicum and its construction method for synthesizing geraniol And application, its construction method is: the mutant geranyl pyrophosphate synthase gene ERG20F96W-N127W of Saccharomyces cerevisiae source and the geraniol synthase gene tVoGES of valerian root truncated 53 amino acid residues of C terminal by fusion PCR The method is connected, and the homologous region is added with ribosome binding site sequence, inserted into the SacI and XbaI restriction sites of the expression plasmid pEC-XK99E of Corynebacterium glutamicum to obtain plasmid 1; plasmid 1 is transformed into Corynebacterium glutamicum, and obtained Corynebacterium glutamicum 1 for synthesizing geraniol; this invention provides more precursors for the synthesis of geraniol, the fermentation time is 42-48 hours shorter, and no corresponding by-products are detected by temperament detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corynebacterium and colibacillus double expression vector with high copy capability and building method thereof
  • Corynebacterium and colibacillus double expression vector with high copy capability and building method thereof
  • Corynebacterium and colibacillus double expression vector with high copy capability and building method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A method for constructing a double expression vector of coryneform bacteria and escherichia coli with high copy capacity, comprising the following steps:

[0042] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 1 with a length of 2283 bp and DNA fragment 2 with a length of 4348 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to T by PCR amplification;

[0043] The nucleotide sequences of the primers are as follows:

[0044] Construction of DNA fragment 1 primers:

[0045] C1786T-F: gtttctacaaactcttttgtttatttttctaaatac (SEQ ID NO: 1)

[0046] C1786T-R: agttagtagctcgcacggg (SEQ ID NO: 2)

[0047] Construct DNA fragment 2 primers:

[0048] V-C1786T-F: tgcgagctactaactcatatgcacg (SEQ ID NO: 3)

[0049] V-C1786T-R: gaattcgagctcggtacccgg (SEQ ID NO: 4)

[0050] The PCR reaction system is sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a corynebacterium and colibacillus double expression vector with high copy capability. The nucleotide sequence of an expression plasmid is shown as SEQ ID NO:9. Through artificial mutagenesis on a nucleotide C in a 1786-th site in a corynebacterium replicon regulation position of a pXMJ19 carrier, a corynebacterium / colibacillus dual-purpose vector pXMJ19C1786T plasmid with the copy capability being about 12.5 times higher than that of a pXMJ19 plasmid is successfully obtained. The copy number of the pXMJ19 plasmid in the corynebacterium is about 20; and the copy number of the pXMJ19C1786T plasmid in the corynebacterium is 251. Meanwhile, the invention also discloses a building method of the expression plasmid.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a coryneform bacterium and Escherichia coli double expression vector with high copy capacity and a construction method thereof. Background technique [0002] The biggest feature of a good genetically engineered vaccine is that it does not carry any infectious virus, so it will not cause toxic and side effects caused by virus infection, making it safer and more reliable. In addition, compared with the traditional vaccine production process, genetically engineered vaccines have the advantages of simpler, easier quality control, and easier storage and transportation. As a new type of biotechnology, the application of genetically engineered vaccines is constantly expanding, and has gradually become a new trend in the development of epidemic prevention and control in the economy and society. There are two main types of genetically engineered vaccines: one is nucleic acid vacc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/77C12N15/69
CPCC12N15/69C12N15/77
Inventor 陈瑞爱黄梅李延鹏刘定祥闫圆圆方倪冉杨小云董楠
Owner ZHAOQING INST OF BIOTECHNOLOGY CO LTD