Effect of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells

A technology of adipogenic differentiation and osteogenic differentiation, applied in the field of stem cells, can solve problems that have not been reported

Active Publication Date: 2020-09-15
北京中卫医正科技有限公司 +1
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the role of LINC02075 in the adipogenic and osteogenic differentiation of bone marrow mesenchymal stem cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Effect of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells
  • Effect of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells
  • Effect of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Fluorescent quantitative PCR detection of LINC02075 expression level during adipogenic induction

[0035] 1. Adipogenic Induction

[0036] (1) The third-generation human bone marrow mesenchymal stem cells (purchased from Sciencell) in the logarithmic growth phase were selected and inoculated into culture flasks, and cultured by adding complete medium;

[0037] (2) When the cell confluency reached 70%, the medium was replaced with adipogenic induction medium every 3 days, and RNA was extracted after 14 days of adipogenic induction.

[0038] 2. RNA extraction

[0039] RNA was extracted on day 0, day 7 and day 14 respectively, and three controls were set in each group.

[0040] (1) Remove the medium, add 500 μL Trizol to each well, and repeatedly pipette the cells until a clear and non-viscous liquid is formed;

[0041] (2) Transfer the mixture to a 1.5ml EP tube, add 100μL chloroform, shake vigorously on the shaker for 15 seconds, and let stand at room temperature for ...

Embodiment 2

[0060] Fluorescent quantitative PCR detection of the inhibitory effect of sh-LINC02075

[0061] (1) The sequence of sh-LINC02075 is as follows:

[0062]Sense strand: 5'-CACCGCTCCTGAAGAAACAGCTTAGCGAACTAAGCTGTTTCTTCAGGAGC-3' (SEQ ID NO. 6)

[0063] Antisense strand: 5'-AAAAGCTCCTGAAGAAACAGCTTAGTTCGCTAAGCTGTTTCTTCAGGAGC-3' (SEQ ID NO.7)

[0064] (2) The lentiviral vector was constructed by Jikai Genomics Co., Ltd., and the bone marrow mesenchymal stem cells were transfected according to the transfection instructions. After 48 hours, the RNA was extracted for quantitative fluorescence detection. The steps were the same as in Example 1.

[0065] Experimental results

[0066] Experimental results such as figure 2 As can be seen from the figure, the inhibition rate of sh-LINC02075 was 70.4%.

Embodiment 3

[0068] Effects of inhibiting LINC02075 on the mRNA levels of genes PPARγ, C / EBPα and AP2 related to adipogenic differentiation of bone marrow mesenchymal stem cells

[0069] gene name Primer sequence PPARγ GCCCAGGTTTGCTGAATGTG (SEQ ID NO. 8) TTGGCAAACAGCTGTGAGGA (SEQ ID NO. 9) C / EBPa AGAACAGCAACGAGTACCGG (SEQ ID NO. 10) GCGGTCATTGTCACTGGTCA (SEQ ID NO. 11) AP2 TGGGCCAGGAATTTGACGAA (SEQ ID NO. 12) CCATCCCATTTCTGCACATGT (SEQ ID NO. 13)

[0070] 2. Bone marrow mesenchymal stem cells transfected with sh-NC and sh-LINC02075 were inoculated on a culture plate for adipogenic induction. After 14 days of adipogenic induction, RNA was extracted, and fluorescent quantitative PCR was used to detect sh-NC group and sh- Expression differences of PPARγ, C / EBPa and AP2 among LINC02075 groups.

[0071] Experimental results

[0072] Experimental results such as image 3 As shown, it can be seen from the figure that after inhibiting LIN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an effect of long-chain non-coding RNA in adipogenic differentiation and osteogenic differentiation of stem cells, and belongs to the technical field of stem cells. Experimentsprove that in the adipogenic differentiation process of mesenchymal stem cells, the expression quantity of the LINC02075 is obviously increased, inhibition of LINC02075 can obviously inhibit mRNA andprotein expression of adipogenic differentiation related genes PPAR gamma, C/EBP alpha and AP2, thereby inhibiting the adipogenic differentiation of the mesenchymal stem cells. Meanwhile, the invention proves that inhibition of LINC02075 can significantly promote mRNA and protein expression of osteogenic differentiation related genes RUNX2, ALP and OCN to promote osteogenic differentiation of themesenchymal stem cells

Description

technical field [0001] The invention belongs to the technical field of stem cells, and in particular relates to the application of a long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells. Background technique [0002] Osteoporosis is a systemic, metabolic bone disease. The main pathological features of osteoporosis are decreased bone mass, damaged bone microarchitecture and increased bone fragility, and its main clinical manifestations are pathological fractures and low back pain. With the continuous aggravation of the aging level, osteoporosis has begun to attract more and more people's attention. [0003] Bone marrow mesenchymal stem cells are a type of stem cells with multiple differentiation and self-renewal capabilities, which can differentiate into osteoblasts, chondrocytes, adipocytes, nerve cells, myoblasts, etc. under different conditions. Bone marrow mesenchymal stem cells have the advantages of easy acquisition, les...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00C12N15/113A61P19/10A61K31/713
CPCC12N15/113A61P19/10A61K31/713
Inventor 不公告发明人
Owner 北京中卫医正科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap