Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides

An oblique bander, monoclonal antibody technology, applied in chemical instruments and methods, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems of difficulty in simultaneous identification of IgM heavy chains and the like

Inactive Publication Date: 2020-10-09
SOUTH CHINA AGRI UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims to solve the problem that it is difficult to simultaneously identify two IgM heavy chains of the grouper, and provides a method for preparing a monoclonal antibody capable of recognizing two IgM heavy chains of the grouper. By constructing a unique IgM The prokaryotic expression vector expresses and purifies IgM recombinant protein. The prepared monoclonal antibody can simultaneously recognize two bands of 80kDa and 50kDa in the serum of the grouper. cells, laying the foundation for further research on the functions of the two IgM heavy chains of the grouper

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides
  • Preparation method of monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides
  • Preparation method of monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0086] A method for preparing a monoclonal antibody capable of recognizing two IgM heavy chains of grouper, comprising the following steps:

[0087] 1. Construction of IgM prokaryotic expression vector

[0088] (1), IgM heavy chain constant region fragment amplification

[0089] According to the sequence of the IgM heavy chain constant region of the grouper, the amplification primers IgM-HCF: CCACTCCAAATGCACCAACTGTG and IgM-HCR: GTGCTTACTTACATGCAAGACTATAAGTTT were designed to amplify by PCR using the cDNA of the grouper spleen as a template, and the reaction procedure was: 98 ℃, 10s; 55℃, 15s; 72℃, 2min; 35 cycles, 72℃ extension 5min; after PCR, the gel recovered the reaction product;

[0090] (2), the product is connected to the carrier

[0091] A. Mix 4 μL of the recovered product with 1 μL of pEASY-Blunt Cloning Vector, and connect at 25°C for 30 minutes;

[0092] B. The ligation product was added to 100 μL of bacterial competent cells and kept in ice bath for 30 minutes...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims to solve the problem that two IgM heavy chains of epinephelus coioides are difficult to recognize at the same time, and provides a preparation method of a monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides. A unique IgM prokaryotic expression vector is constructed; IgM recombinant protein is expressed and purified, the prepared monoclonal antibody can recognize 80kDa and 50kDa of two bands in epinephelus coioides serum at the same time, the monoclonal antibody can effectively mark B cells in epinephelus coioides head kidney slices, and afoundation is laid for further researching functions of two IgM heavy chains of epinephelus coioides.

Description

technical field [0001] The invention belongs to the field of preparation and application of monoclonal antibodies, and in particular relates to a preparation method of monoclonal antibodies capable of recognizing two IgM heavy chains of grouper. Background technique [0002] Epinephelus coioides belongs to Perciformes, Serranidae, and Epinephelus. It is a rare and valuable seawater fish mainly cultivated in my country and Southeast Asia. In recent years, due to reasons such as excessive breeding density and deterioration of the breeding environment, frequent disease outbreaks have seriously threatened the development of the grouper industry. Among the parasitic diseases, cryptocystosis is the most serious, causing countless economic losses every year. Immunization against stimulatory cryptocystosis is considered to be an effective method. However, the lack of antibodies to B cell-specific markers hampers the study of mechanisms that stimulate host-specific humoral immune r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/42C12N15/70C07K16/00
CPCC07K16/00C07K16/4283C07K2317/14C07K2317/35C12N15/70
Inventor 李言伟但学明赖学礼莫泽权
Owner SOUTH CHINA AGRI UNIV