Preparation method of monoclonal antibody capable of recognizing two IgM heavy chains of epinephelus coioides
An oblique bander, monoclonal antibody technology, applied in chemical instruments and methods, recombinant DNA technology, introduction of foreign genetic material using vectors, etc., can solve the problems of difficulty in simultaneous identification of IgM heavy chains and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0086] A method for preparing a monoclonal antibody capable of recognizing two IgM heavy chains of grouper, comprising the following steps:
[0087] 1. Construction of IgM prokaryotic expression vector
[0088] (1), IgM heavy chain constant region fragment amplification
[0089] According to the sequence of the IgM heavy chain constant region of the grouper, the amplification primers IgM-HCF: CCACTCCAAATGCACCAACTGTG and IgM-HCR: GTGCTTACTTACATGCAAGACTATAAGTTT were designed to amplify by PCR using the cDNA of the grouper spleen as a template, and the reaction procedure was: 98 ℃, 10s; 55℃, 15s; 72℃, 2min; 35 cycles, 72℃ extension 5min; after PCR, the gel recovered the reaction product;
[0090] (2), the product is connected to the carrier
[0091] A. Mix 4 μL of the recovered product with 1 μL of pEASY-Blunt Cloning Vector, and connect at 25°C for 30 minutes;
[0092] B. The ligation product was added to 100 μL of bacterial competent cells and kept in ice bath for 30 minutes...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap