Unlock instant, AI-driven research and patent intelligence for your innovation.

Meloidogyne disease related miRNA as well as regulatory gene, protein and application thereof

A root-knot nematode and anti-root-knot nematode technology, applied in DNA/RNA fragmentation, application, genetic engineering, etc., to achieve the effect of safe and sustainable control, reduction of agricultural input, and alleviation of environmental pollution

Active Publication Date: 2021-03-16
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no studies have shown that CRFs are associated with resistance to root-knot nematodes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Meloidogyne disease related miRNA as well as regulatory gene, protein and application thereof
  • Meloidogyne disease related miRNA as well as regulatory gene, protein and application thereof
  • Meloidogyne disease related miRNA as well as regulatory gene, protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 PCR amplification of miRNA miRcn1 gene and construction of pEarleyGate202+miRcn1 recombinant vector

[0077] 1.1 Design primers

[0078] Using miRcn1 mature sequence SEQ ID NO.1 (taacttcgtctagctcgccttc) and RPS300 plasmid, using the software WMD3 (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi) to design primers, a total of 4 primer sequences were generated, The sequences were named as I miRcn1-s, II miRcn1-a and III miRcn1*s, IV miRcn1*a respectively, and were numbered as SEQ ID NO.2-SEQ ID NO.5.

[0079] SEQ ID NO.2 (I miRcn1-s):

[0080] ga taacttcgtctagctcgccttc tctctcttttgtattcc

[0081] SEQ ID NO.3 (II miRcn1-a):

[0082] ga gaaggcgagctagacgaagtta tcaaagagaatcaatga

[0083] SEQ ID NO.4 (III miRcn1*s):

[0084] ga gacggcgagctagtcgaagtta tcacaggtcgtgatatg

[0085] SEQ ID NO.5 (IV miRcn1*a):

[0086] ga taacttcgactagctcgccgtc tctacatatatattcct

[0087] Among them, the underlined part is the mature sequence of miRcn1 to obtain the complementa...

Embodiment 2

[0098] Example 2 PCR amplification of CRF9 and construction of pEarleyGate202+CRF9 recombinant vector

[0099] The genome sequence SEQ ID NO.10 of tomato (Solanum lycopersicum) Moneymaker cDNA was used as a template. Using SEQ ID NO.8 and SEQ ID NO.9 as primers, the high-fidelity enzyme Phanta Max Super-FidelityDNA Polymerase (Novizyme, Nanjing, China) was used to amplify the gene CRF9. The sequence number of the amplified product CRF9 is SEQ ID NO.10.

[0100] SEQ ID NO.8: 5'-ccggaattcatggatggttgcattagttc-3'

[0101] SEQ ID NO.9: 5'-cgcggatccttataccaaaactgcatcta-3'

[0102] SEQ ID NO.10:

[0103] atggatggttgcattagttcagtgaggaaagttcgcatagtttatgatgatcctgatgctacgga ctctgagagcgatgatgatcagaatgctgctcgtttcgataaaaatgtgaacagaatcaagcgtg ttgttaaggaaattgttattcctgttgtttcatgggagaatgattttaaaaaatgttctaaactt gataacattaggattaaagattccaagaagattcatgaaaataagaaggtgcagctaaaatcgac cgcgttgcctaaaggagttaggatgaggaaatgggggaaatatgcagctgagatcagagatccct cgcaggggaaaagaatatggttagggacttttgagactgtggaggcggcttca...

Embodiment 3

[0107] Example 3 Recombinant Agrobacterium tumefaciens GV3101+CRF9 and recombinant Agrobacterium tumefaciens GV3101+miRNA miRcn1

[0108] 3.1. Preparation of Agrobacterium tumefaciens GV3101 Competent Cells

[0109] Activate GV3101 on solid medium plate of LB [50mg / l rifampicin (Rif)], 1-2d. A single colony GV3101 was picked and inoculated in 5ml LB (50mg / l Rif) liquid medium at 28°C, 200 rpm, overnight. Take 2ml of the culture into 50ml of LB liquid medium, at 28°C, 200rpm, and continue to cultivate until the OD600 is about 0.5. Place the culture on ice, ice-bath for 30min, centrifuge at 5000rpm at 4°C for 5min, and discard the supernatant. Suspend the cells with 10 ml of refrigerated 0.1 mol / l NaCl; centrifuge at 5000 rpm for 5 min at 4°C, and discard the supernatant. Suspend with 1ml of refrigerated 20mmol / l CaCl2, aliquot into 50uL / tube (final concentration of glycerol is 20%), and store at -80°C after quick freezing in liquid nitrogen.

[0110] 3.2. Transformation of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a meloidogyne disease related miRNA, as well as a regulatory gene, protein and application thereof. The miRNA is miRcn1, and the gene regulated by the miRcn1 comprises CRF9; theprotein is coded by the regulatory gene of the meloidogyne disease related miRNA provided by the invention; and the application comprises resistance to meloidogyne disease. Experiments prove that miRNA miRcn1 and a target gene CRF9 of miRNA miRcn1 play an important role in prevention and treatment of meloidogyne. Overexpression of the miRNA miRcn1 and silencing of the target gene CRF9 can improvethe resistance of plants to meloidogyne.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a root-knot nematode-related miRNA and its regulation gene, protein and application. Background technique [0002] Root-knot nematode (Meloidogyne spp.) is one of the most serious plant parasitic nematodes in the world, causing economic losses of tens of billions of dollars every year. Among them, root-knot nematode incognita has a wide range of hosts and can harm hundreds of plants, and tomato and other crops caused huge economic losses after being infected by it. Current control methods against the disease include chemical nematicides, crop rotation, and selection of resistant varieties, but these measures have serious limitations. Chemical nematicides have certain unsafe effects on humans and animals, and are likely to pollute the environment. Therefore, it is more and more urgent to seek new measures to control root-knot nematode disease. [0003] In order to resist the infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82C12N15/84C12N1/21C12N15/29A01H5/00A01H6/82
CPCC12N15/8218C12N15/8285C07K14/415
Inventor 周冬梅魏利辉王纯婷
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES