Preparation and application of a kind of tn5 mutant enzyme

A mutant, transposase technology, applied in DNA preparation, biochemical equipment and methods, enzymes, etc., can solve problems such as restriction fragmentation reactions, and achieve the effects of not easy to degrade, high sequencing saturation, and enhanced stability

Active Publication Date: 2022-04-15
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the existing E54K, L372PTn5 transposases have a preference for target DNA, which greatly limits the fragmentation reaction of Tn5 transposases to DNA from different species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of a kind of tn5 mutant enzyme
  • Preparation and application of a kind of tn5 mutant enzyme
  • Preparation and application of a kind of tn5 mutant enzyme

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: the preparation of mutant Tn5 transposase

[0026] 1. Construct the vector containing the nucleotide sequence encoding the mutant Tn5 transposase

[0027] (1) Delete amino acids 2-6 and amino acids 373-391 of the N-terminal of E54K, L372P Tn5 transposase and mutate alanine at position 466 to cysteine. Using the method of gene synthesis, synthesize the nucleotide sequence of mutant Tn5 transposase (comprising mutant Tn5 transposase, intein and chitin binding domain), and connect to NdeI and BamHI restriction sites of pTXB1 vector In the middle, a complete plasmid is formed.

[0028] (2) Take 20 ul of the ligated product, add 100 ul of BL21(DE3) competent E. coli, gently flick the tube wall several times, and place the tube on ice for 30 min. Heat shock at 42°C for 90s, then cool on ice for 2min. Add 900ul of SOC medium to the tube and shake the bacteria at 37°C for 1h. Take 100ul bacterial liquid and spread it on the plate containing ampicillin. Invert...

Embodiment 2

[0033] Example 2: Comparison of properties of mutant Tn5 transposase and E54K, L372P transposase

[0034] (1) Construction of fragmented DNA library

[0035] Prepare a treatment system using genomic DNA as a template, the reaction system is as follows: 25mM Tris-HCl pH=8.5, 5mM MgCl 2 , 200 nM of the mutant Tn5 transposase obtained in Example 1, 100 ng of genomic DNA, 1 ng of a linker primer containing a 19 bp transposon sequence; reaction conditions: 55° C., 7 min.

[0036] The primer containing the 19bp transposon linker includes: a transposase recognition sequence, a first linker sequence; a second linker sequence.

[0037] Transposase recognition sequence: AGATGTGTATAAGAGACAG;

[0038] The first linker sequence (XXXXXX represents the Index sequence):

[0039] AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT;

[0040] The second linker sequence (XXXXXX represents the Index sequence):

[0041] CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses the preparation and application of a Tn5 mutant enzyme, belonging to the field of biotechnology. Mutating the existing E54K, L372P mutated Tn5 transposase can significantly improve the efficiency of the fragmentation reaction. The mutation changes the protein sequence of the Tn5 transposase to delete the redundant amino acid sequence of the Tn5 transposase, and solves the problem of low efficiency and preference of the original Tn5 tagging reaction. The mutant Tn5 transposase can more effectively improve the reaction efficiency, and the stability of the enzyme is significantly improved.

Description

technical field [0001] The invention relates to the preparation and application of a Tn5 mutant enzyme, which belongs to the field of biotechnology. Background technique [0002] Scientists first discovered the phenomenon of transposition in the study of corn, and in the following decades, researchers successively discovered the widespread existence of transposition in the biological world. When the transposition phenomenon occurs, the genome will change, so the transposition system can be fully studied and modified, and the transposition system can be developed into a powerful tool for studying genes. Transposition tag technology is currently the most widely used transposition tool. The basic principle is that transposomes can recognize a fixed DNA sequence, cut it, and then connect the DNA fragments it carries to both ends of the cut. However, since the transposition activity of naturally occurring transposases is very low, the mutation modification of natural transposase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/10C12N15/70C12Q1/6806
CPCC12N9/1241C12N15/1031C12N15/70C12Q1/6806C12Q2531/113C12Q2535/122
Inventor 朱升龙陈永泉张靖伟王振姜旋
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products