Acidithiobacillus caldus-sourced EpsRAc transcriptional regulation factor and application thereof in copper oxidation tolerance

A transcriptional regulator, tolerance technology, applied in the fields of biochemistry and molecular biology, can solve the problems of copper ore grade decline, high energy consumption and environment

Active Publication Date: 2022-01-07
JIANGNAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, the continuous consumption of high-grade copper resources has led to a rapid decline in the grade of copper ore
High energy consumption and environmental issues pose challenges to traditional pyrometallurgy and hydrometallurgy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acidithiobacillus caldus-sourced EpsRAc transcriptional regulation factor and application thereof in copper oxidation tolerance
  • Acidithiobacillus caldus-sourced EpsRAc transcriptional regulation factor and application thereof in copper oxidation tolerance
  • Acidithiobacillus caldus-sourced EpsRAc transcriptional regulation factor and application thereof in copper oxidation tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Determination of the epsR promoter

[0033] (1) Promoter prediction: In order to determine the promoter of the epsR gene, the A. caldus epsR gene (nucleotide sequence such as SEQ ID NO. 1) including the upstream sequence, ranging from genomic nucleotides 251,431 to 258,533. The possible promoters of this region were predicted using the softberry BPROM website, and the prediction results were as follows figure 1 As shown, each promoter contains -35 region (TTGACA) and -10 region (TATAAT) which are relatively conserved in biological sense.

[0034] The predicted promoter is located between the epsR gene and ACAty_RS01295, such as figure 1 , the genes adjacent to the epsR gene are also shown in figure 1 In addition, it also contains information such as the -35 region and the -10 region of the PI promoter.

[0035] PI (SEQ ID NO.3):

[0036] TGTGTGCTCACACGATGAACATGGGCACGAGCATAGGGTGTCTGTTGCTGGAGTGTCAAGTTGCGGAGCTCTGGCGTTTATTACCCCAAGGGCAACATGCCGGATCTCCCGCATCAGA...

Embodiment 2

[0051] Example 2: Participating in the transcriptional regulator EpsR Ac Heavy metal ion specificity of regulatory processes

[0052] Therefore, the pJN19-Pro-EGFP series recombinant plasmids were constructed, and the promoter fragment and epsR gene were introduced into the pJN19-EGFP plasmid together, and the expression level of EGFP fluorescent protein was studied to study the transcriptional regulatory factor EpsR. Ac Heavy metal ion specificity of regulatory processes. Include the following steps:

[0053] (1) Construction of pJN19-Pro-EGFP series recombinant plasmids: the predicted promoter gene and epsR gene were fused by homologous recombination (the promoter gene was directly connected to the epsR gene) and inserted into the plasmid pJN19-EGFP (the promoter gene Insert the epsR gene into the pJN19-EGFP vector between the EGFP and PstI restriction sites), construct the recombinant plasmid, transform the recombinant plasmid into E.coli DH5α, culture until a single colo...

Embodiment 3

[0057] Example 3: Transcription Regulator EpsR Ac Effects on copper tolerance of Escherichia coli

[0058] To explore EpsR Ac In the application of copper resistance, the epsR gene is introduced into Escherichia coli, and its function is verified, including the following steps:

[0059] (1) Construction of the recombinant plasmid pRSFDuet-1-epsR: Taking the genomic DNA of the type strain A.caldus ATCC 51756 as a reference, the epsR gene was introduced into the BamHI and SalⅠ sites of the plasmid pRSFDuet-1 by homologous recombination, and the recombinant plasmid pRSFDuet-1-epsR was introduced into Escherichia coli BL21, named BL21-epsR, and primers UP-1 and Down-1 were used to detect whether the gene was introduced, and the nucleic acid gel electrophoresis picture was as follows Figure 5 , the primer sequences are as follows:

[0060] UP-1: GGATCTCGACGCTCTCCCCT,

[0061] Down-1: GATTATGCGGCCGTGTACAA;

[0062] (2)EpsR Ac Effect on copper tolerance of Escherichia coli: ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Acidithiobacillus caldus-sourced EpsRAc transcriptional regulation factor and application thereof in copper oxidation tolerance, and belongs to the field of biochemistry and molecular biology. According to the present invention, the promoter sequence derived from the Acidithiobacillus caldus transcriptional regulation factor EpsRAc and the heavy metal specificity participating in the regulation of the transcriptional regulation factor EpsRAc are analyzed; through heterologous expression in Escherichia coli, the effect of EpsRAc on the aspect of copper ion tolerance is proved.The co-purification of the EpsRAc protein and the copper ions shows that the copper ions may indirectly regulate and control the EpsRAc protein so as to achieve the purpose of transcriptional regulation and control. According to the method, a foundation is laid for improving the copper resistance of the acidithiobacillus caldus through metabolic means such as transcriptional regulation and the like in the later period, so that the biological leaching of heavy metal ions of copper ore is improved.

Description

technical field [0001] The present invention relates to an EpsRAc transcription regulator derived from Acidithiobacillus caldus and its application in tolerance to copper oxidation, in particular to the MarR family isolated from Acidithiobacillus caldus and related to EPS secretion transcriptional regulator EpsR Ac The coding gene and application thereof belong to the field of biochemistry and molecular biology. Background technique [0002] At present, the continuous consumption of high-grade copper resources has led to a rapid decline in the grade of copper ore. High energy consumption and environmental issues pose challenges to traditional pyrometallurgy and hydrometallurgy. Bioleaching has the advantages of simple process, low energy consumption, and environmental friendliness, and is widely used for leaching low-grade copper ores and complex ores. Bioleaching produces copper sulphate-containing mother liquors produced by microbial dissolution of insoluble copper sulp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/70C22B3/18C22B15/00
CPCC07K14/195C12N15/70C22B3/18C22B15/0065Y02P10/20
Inventor冯守帅杨海麟尹伊君仝艳军陆潇洋邱永康
OwnerJIANGNAN UNIV