Primer pair probe combination product and its kit and detection method for detecting mitochondrial 3243a>g mutation

A combination product and detection probe technology, applied in the field of genes, can solve the problems of not being able to provide guidance to doctors in time, high cost of chip method, and long time period, and achieve intuitive and easy interpretation of results, short detection time consumption, and low cost Effect

Active Publication Date: 2022-04-26
GUANGZHOU JIAJIAN MEDICAL TESTING CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among these traditional technologies, the direct sequencing method has a long time period and cannot provide timely guidance to doctors; the high cost of the chip method limits its application to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair probe combination product and its kit and detection method for detecting mitochondrial 3243a>g mutation
  • Primer pair probe combination product and its kit and detection method for detecting mitochondrial 3243a>g mutation
  • Primer pair probe combination product and its kit and detection method for detecting mitochondrial 3243a>g mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Screening of primers and probes

[0059] Step 1: m. 3243A>G primer and probe design and selection

[0060] Find the sequence near the mitochondrial site 3243: Search the mitochondrial genome sequence information (NC_012920.1) on NCBI, intercept the sequence of 300~500bp upstream and downstream of the 3243 site for primer probe design, and the underlined one is m.3243 A> G-site.

[0061] GTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAG A GCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTA

[0062] With the aid of primer and probe design software oligo 7 and Primer Premier 5.0 software, 13 upstream primers and 2 sets of downstr...

Embodiment 2

[0084] Embodiment 2: Optimization of reaction system and reaction program

[0085] The optimal reaction system was established through the study of different Mix usage amounts, different primers, probe concentrations and amounts, and different amounts of DNA templates; the optimal reaction program was established through the research of different annealing temperatures, times, and cycle numbers. The reaction system and reaction program are shown in Table 8-Table 11.

[0086] Specifically, the mitochondrial gene 3243A>G mutation detection kit (fluorescent PCR method) includes the following steps:

[0087] S1: Nucleic acid extraction;

[0088] S2: Reaction solution configuration;

[0089] S3: add sample;

[0090] S4: qPCR amplification;

[0091] S5: Data analysis.

[0092] Step S1 is specifically: vortex the centrifuge tube containing the oral swab for 1 min to completely elute the exfoliated cells in the oral cavity, and discard the swab. Take 0.2ml of oral exfoliated cel...

Embodiment 3

[0115] Embodiment 3: the research of positive judgment value

[0116] Step 1: Determine the reference value of the internal reference gene

[0117] When the concentration of added DNA is excessive, it is easy to generate false positive signals. When the concentration of DNA is insufficient or PCR has inhibitors, false negative signals are prone to occur. Therefore, it is necessary to use the internal reference gene amplification to monitor the quality of the added DNA template and to monitor each DNA amplification in each reaction well.

[0118] The DNA of 60 oral swab samples was randomly selected for 10-fold serial dilution to 0.1ng / μL for detection, and the reference range of Ct value was calculated. The results show that when the DNA concentration is 0.1ng / μL, the Ct value is distributed between 23 and 26, the average value is 24.34, and the standard deviation SD is 0.75. The reference range of the Ct value of the internal reference is the average value plus 2 times the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene technology, in particular to a primer-pair-probe combination product for detecting mitochondrial 3243A>G mutation, a kit and a detection method thereof. The invention uses ARMS combined with fluorescent PCR technology to have high specificity and high sensitivity, short detection time, low cost, intuitive and easy interpretation of results.

Description

technical field [0001] The invention relates to the field of gene technology, in particular to a primer-pair-probe combination product for detecting mitochondrial 3243A>G mutation, a kit and a detection method thereof. Background technique [0002] Mitochondria are important organelles in eukaryotic cells and provide energy for cells, and their oxidative metabolism provides more than 80% of the energy for the body. Mitochondrial DNA (mitochondrial DNA, mtDNA) is the extrachromosomal genome of the cell nucleus, which has self-replication, transcription and coding functions. It is a relatively independent genetic control system, but it is also controlled by nuclear DNA. The human mtDNA molecule is a 16569bp double-stranded closed-circle supercoiled DNA molecule, including a light chain (L chain) and a heavy chain (H chain), IL, IH1 and IH2 are the transcription initiation points of the L chain and H chain respectively , including 13 polypeptide coding genes, 22 tRNA genes ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor张巍
OwnerGUANGZHOU JIAJIAN MEDICAL TESTING CO LTD