Specific gene knockout CRISPR/Cas9 editing plasmid containing double sgRNA and application of CRISPR/Cas9 editing plasmid
A gene knockout and specific technology, applied in the field of genetic engineering, can solve the problems of huge secondary metabolite network and complex genome structure, and achieve the effect of improving gene knockout efficiency and simplifying genetic engineering operations.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 sgRNA design for targeted knockout
[0043] Step 1. The selected knockout fragment is a fragment of 87.5 kb located on the ECO-0501 biosynthetic gene cluster of the A. Keratiniphila HCCB10007 strain, and the specific positions are AORI_2930-AORI_2954.
[0044] Step 2. Use the sgRNA online design tool CCTop-CRISPR / Cas9 target online predictor to design and screen sgRNA fragments based on the fragment to be knocked out. The two sgRNA sequences are:
[0045] sgRNA-1:ACTCGGGATCTCCTGACTTG(PAM:GGG), (SEQ ID NO.1);
[0046] sgRNA-2:CAAAGGACAGAAAAGAAAGG (PAM:TGG), (SEQ ID NO. 2).
[0047] Step 3, synthesizing the corresponding oligonucleotide fragment (the lowercase part is the homology arm when it is connected with the carrier)
[0048] sgRNA-1 oligo-F:atttctagctctaaaacCAAGTCAGGAGATCCCGAGTactagttcctaccaaccggcacg, (SEQ ID NO. 3);
[0049] sgRNA-1 oligo-R: cgtgccggttggtaggaactagtACTCGGGATCTCCTGACTTGgttttagagctagaaat, (SEQ ID NO. 4);
[0050] sgRNA-2 oligo-F:atttcta...
Embodiment 2
[0055] Example 2 Synthesis of upstream and downstream homology arms for homologous recombination repair after gene knockout
[0056] Step 1. Using the genome sequence of A.keratiniphila HCCB10007 as a template, design and synthesize amplification primers:
[0057] arm-aF:acgacggccagtgccaagcttCCGGATACACCAAGAGCACATCA, (SEQ ID NO. 7);
[0058] arm-aR:acgggcgatcTTGCCGAGGAGCCTAGAGGAC, (SEQ ID NO. 8);
[0059] arm-zF:tcctcggcaaGATCGCCCGTCCCCACCGAGCGT, (SEQ ID NO. 9);
[0060] arm-zR: ggtgctttttttgagaagcttGGATCAAGGCAACCTGCTGTG, (SEQ ID NO. 10).
[0061] Step 2. Using the genome of A.keratiniphila HCCB10007 as a template, PCR amplification was performed using the primers shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10 respectively, and the reaction system and PCR program As shown in Table 2 (take the amplification of arm-aF and arm-aR as an example, the amplification of arm-zF and arm-zR is the same as in Table 2, replace arm-aF and arm-aR with arm-zF and arm- zR)...
Embodiment 3
[0065] Example 3 Construction of CRISPR / Cas9 Editing Plasmid Containing Double sgRNA-specific Gene Knockout
[0066] Step 1. Use Hind III to digest the pLYNY04 plasmid to obtain the digested vector. Reaction conditions: 37°C, 4h; the reaction system is shown in Table 3:
[0067] Table 3 Reaction system
[0068] Hind III 2.5μl 10×M buffer 5μl pLYNY04 2.5μg wxya 2 o
Xμl Total 50μl
[0069] Step 2: Purify the digested plasmid product using the Gel Recovery Kit, and operate according to the instructions.
[0070] Step 3. Ligate the purified linearized vector with the amplified upstream and downstream homology arms to obtain the backbone plasmid, and adopt the overlap recombination method. Reaction conditions: react at 37°C for 30 minutes, immediately lower to 4°C or immediately Place on ice to cool; the reaction system is as shown in Table 4:
[0071] Table 4 reaction system
[0072]
[0073]
[0074] Remarks: The optimal a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More