Unlock instant, AI-driven research and patent intelligence for your innovation.

FGFR2c extracellular domain analogue as well as coding gene and application thereof

A technology encoding gene and extracellular segment, which is applied to FGFR2c extracellular segment analogs and their encoded genes and application fields, can solve the problem of polypeptide stability to be improved, and achieve the effect of inhibiting pulmonary fibrosis.

Pending Publication Date: 2022-05-06
汪炬
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inventors of this application once provided the application of the extracellular segment of FGFR2IIIc in the preparation of drugs for the prevention and / or treatment of idiopathic pulmonary fibrosis (CN200810198967.X), and the patent number is ZL201410347938.0 "FGFR2c extracellular segment analogs and their coding In "Genes and Applications", a FGFR2c extracellular segment sequence is (149-360) amino acids, which is more stable than the previously published extracellular segment sequence (147-366) and (151-377) and (150-366 ) are more stable, but it was accidentally found in practical applications that the stability of the above polypeptides needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FGFR2c extracellular domain analogue as well as coding gene and application thereof
  • FGFR2c extracellular domain analogue as well as coding gene and application thereof
  • FGFR2c extracellular domain analogue as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Expression of wild-type and mutant FGFR2c extracellular segment analog polypeptide genes in Escherichia coli Prokaryotic expression of the 149-382th amino acid FGFR2c extracellular segment

[0055] 1. Construction of recombinant plasmid and expression and identification of FGFR2c extracellular segment by double enzyme digestion and ligation reaction

[0056] Artificially synthesized DNA sequences (SEQ ID NO.3 and SEQ ID NO.4) of wild-type and mutant FGFR2c extracellular segments (149-382 amino acids), with primers added at both ends:

[0057] F: CG CATATG AATAAACGTGCGCCGT (SEQ ID NO.5); the horizontal line is the NdeI restriction site;

[0058] R: AT GGATCC CGCGATTTCCAGGTAA (SEQ ID NO.6); the crossed line is the restriction site of BamH I.

[0059] The extracellular segment gene of FGFR2c was inserted into the prokaryotic expression vector pET30a by restriction endonuclease cutting sites NdeI and BamH I, and the accuracy of the recombinant expression vec...

Embodiment 2

[0065] Example 2: Expression of wild-type and mutant FGFR2c extracellular segment analog polypeptide gene plus Fc segment in CHO cells

[0066] Eukaryotic expression of wild-type and mutant FGFR2c extracellular segment (149-382 amino acids) plus Fc segment fusion protein

[0067] 1. Acquisition of the Fc segment gene

[0068] (1) Primer design:

[0069] F9-Fc:

[0070] 5'-CCCAAGAGCTGCGACAAGACCCACACCTGCCCCCCCTGTCCTGCTCCAGAACTCCTGGGCGGACCCAGCGTGTTCCTGTTCCCCCCAAAGCCCAAGGACACCCTG-3' SEQ ID NO. 7;

[0071] F8-Fc:

[0072]5'-AAGCCCAAGGACACCCTGATGATCAGCAGGACCCCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCACAGGTCAAGTTCAACTGGTACGTGGAC-3' SEQ ID NO.8;

[0073] F7-Fc:

[0074] 5'-TTCAACTGGTACGTGGACGGCGTGCAGGTGCACAACGCCAAGACCAAGCCCCGGGAGCAGCAGTACAACTCCACCTACAGGTGGTGTCCGTGCTGACCGTGCTG-3' SEQ ID NO.9;

[0075] F6-Fc:

[0076] 5'-TCCGTGCTGACCGTGCTGCACCAGAACTGGCTGGACGGCAAAGAGTACAAGTGCAAGGTCTCCAAACAAGGCCCTGCCAGCCCCCATC GAGAAAACCATCAGCAAG-3' SEQ ID NO.10;

[0077] R6-Fc:

[0078] 5'-CAGGG...

Embodiment 3

[0120] Example 3 The extracellular segment of FGFR2c (149-382) can better bind the ligand FGF-2

[0121]The inventor previously applied for and authorized the patent "201410347938.0: FGFR2c Extracellular Segment Analogs and Its Encoding Genes and Applications". 366) and (151-377) and (150-366) are more stable, and now a new sequence (149-382) is designed, compared with the extracellular segment of (149-360), the increased (360-382 ) segment is mainly hydrophilic amino acids, according to the literature (M.Mohammadi et al. / Cytokine&Growth Factor Reviews, 16(2005):107–137), the specificity of FGFR2c subtype receptors binding to ligands mainly comes from the large amount of D3 loop Therefore, a hydrophilic environment is more suitable for better binding of FGF-2 ligands. Most of the amino acids from 382 to the C-terminus of the extracellular segment are hydrophobic amino acids, which are not conducive to the binding of the receptor and the ligand, and cause steric hindrance to t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an FGFR2c extracellular domain analogue as well as a coding gene and application thereof. The FGFR2c extracellular domain analogue comprises the following polypeptides: (1) wild wsFGFR2c, wherein the amino acid sequence of the wsFGFR2c is shown as SEQ ID NO.1; (2) S252W mutant msFGFR2c: the amino acid sequence of the S252W mutant msFGFR2c is shown as SEQ ID NO. 2; or the amino acid sequences of SEQ ID NO.1 and SEQ ID NO.2 have at least 80% homology with the amino acid sequences of SEQ ID NO.1 and SEQ ID NO.2. The reconstructed FGFR2c extracellular domain analogue disclosed by the invention is a polypeptide which can be better combined with an on-membrane receptor FGFR2, eukaryotic expression of an Fc segment is facilitated, and the polypeptide has a very good effect of inhibiting pulmonary fibrosis.

Description

technical field [0001] The present invention relates to the field of biotechnology, and more specifically, the present invention relates to FGFR2c extracellular segment analogs, coding genes and applications thereof. Background technique [0002] Pulmonary fibrosis is the terminal stage of a variety of chronic lung diseases, characterized by pulmonary fibrosis, and eventually death due to loss of lung function, which seriously endangers human life and health. In recent years, international therapeutic drugs targeting IPF targets such as PDGF, VEGF, FGFR, IL-13, IL-4Rα, CTGF, and LOXL2 have also entered clinical trials, but so far most of the drugs only delay the process. The emergence of drugs that can reverse the process of pulmonary fibrosis only delays the process, so it is urgent to develop new, safer and more effective drugs for the treatment of pulmonary fibrosis. [0003] In the process of pulmonary fibrosis, some FGF family members, such as FGF-2, play a role in pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/71C12N15/12C07K19/00C12N15/85C12N5/10A61K38/17A61P11/00A61P35/00
CPCC07K14/71C12N15/85C12N5/0682A61P11/00A61P35/00C07K2319/30C12N2510/00C12N2800/107A61K38/00
Inventor 汪炬
Owner 汪炬
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More