Primer and probe sequence for testing type II pig circular ring virus nucleotide fragment

A porcine circovirus, primer sequence technology, applied in biochemical equipment and methods, DNA/RNA fragments, microorganism determination/inspection, etc., can solve problems such as difficult real-time quantitative detection by conventional PCR, false positives, cross-contamination, etc.

Inactive Publication Date: 2008-10-29
TAITAI GENOMICS +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

E11SA has high sensitivity, but the result judgment is easily affected by subjective factors. The conventional PCR detection method widely used at present is simple, fast and sensitive, but it is prone ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for testing type II pig circular ring virus nucleotide fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Design of primers and probes: Through comparative analysis of all known type II porcine circovirus genome sequences, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is average It is about 20 bases, and there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0012] Upstream primer PCV II pf517:AAATCTCATCATGTCCACCGC

[0013] Downstream primer PCV II pr615: GCTACCGTTGGAGAAGGAAAA

[0014] Probe PCV II pb585:TTCAACACCCGCCTCTCCCGCA

[0015] 2. Establishment and optimization of the reaction system:

[0016] 2.1 Establishment of positive template: The target region template is obtained by the following method: use the inactivated type II porcine circovirus strain as the sample to be tested, use the phenol-chloroform extraction method to extract the viral genomic DNA, and store it at -20°C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a primer sequence and a probe sequence used for detecting ribonucleotide fragments of type 2 porcine circovirus. The primer sequence comprises a primer pair composed of an upstream primer PCV 2 pf517 and a downstream primer PCV 2 pr615, wherein, the sequence of the upstream primer PCV 2 pf517 is AAATCTCATCATGTCCACCGC, and the sequence of the downstream primer PCV 2 pr615 is GCTACCGTTGGAGAAGGAAAA. The probe sequence comprises probe PCV 2 pb585, the sequence of which is TTCAACACCCGCCTCTCCCGCA.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting type II porcine circovirus nucleotide fragments. Background technique [0002] Porcine circovirus (hereinafter referred to as PCV) is a non-enveloped single-stranded circular negative-strand DNA virus with a particle diameter of about 17-20nm. It is one of the smallest animal viruses known so far. PCV is a member of the genus Circovirus in the family Circoviridae. According to its antigenicity and genetic composition, it is divided into two genotypes or serotypes, namely type I PCV (abbreviated as PCV1) and type II PCV (abbreviated as PCV2). ). PCV1 is a virus isolated from the pig cell line PK-15 for the first time in 1974 as a pollutant. Animal experiments show that the virus is non-pathogenic and widely exists in various tissues and organs in normal pigs. PCV2 is closely related to postweaning multisystemic wasting syndrome (PMWS) in recent years. The occurrence and spread of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 胡传伟肖性龙吴斌贾赟张经纬李叶李振荣
Owner TAITAI GENOMICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap